ID: 961432002

View in Genome Browser
Species Human (GRCh38)
Location 3:126890084-126890106
Sequence AGTGAGCTGGAGCACCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 196}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961432002_961432016 21 Left 961432002 3:126890084-126890106 CCCCCAAGGTGCTCCAGCTCACT 0: 1
1: 0
2: 2
3: 15
4: 196
Right 961432016 3:126890128-126890150 GTGCCAGCCGCCTGGAAAGTGGG 0: 1
1: 0
2: 0
3: 14
4: 104
961432002_961432013 13 Left 961432002 3:126890084-126890106 CCCCCAAGGTGCTCCAGCTCACT 0: 1
1: 0
2: 2
3: 15
4: 196
Right 961432013 3:126890120-126890142 TAGGCCATGTGCCAGCCGCCTGG 0: 1
1: 0
2: 1
3: 5
4: 108
961432002_961432019 25 Left 961432002 3:126890084-126890106 CCCCCAAGGTGCTCCAGCTCACT 0: 1
1: 0
2: 2
3: 15
4: 196
Right 961432019 3:126890132-126890154 CAGCCGCCTGGAAAGTGGGTGGG 0: 1
1: 0
2: 2
3: 14
4: 143
961432002_961432018 24 Left 961432002 3:126890084-126890106 CCCCCAAGGTGCTCCAGCTCACT 0: 1
1: 0
2: 2
3: 15
4: 196
Right 961432018 3:126890131-126890153 CCAGCCGCCTGGAAAGTGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 175
961432002_961432015 20 Left 961432002 3:126890084-126890106 CCCCCAAGGTGCTCCAGCTCACT 0: 1
1: 0
2: 2
3: 15
4: 196
Right 961432015 3:126890127-126890149 TGTGCCAGCCGCCTGGAAAGTGG 0: 1
1: 0
2: 0
3: 19
4: 134
961432002_961432010 -6 Left 961432002 3:126890084-126890106 CCCCCAAGGTGCTCCAGCTCACT 0: 1
1: 0
2: 2
3: 15
4: 196
Right 961432010 3:126890101-126890123 CTCACTGTCGGGGCCTTCCTAGG 0: 1
1: 0
2: 0
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961432002 Original CRISPR AGTGAGCTGGAGCACCTTGG GGG (reversed) Intronic
900344214 1:2203445-2203467 ACTGAGCTGGAGCAGCAGGGTGG - Intronic
900964533 1:5948604-5948626 AGTGGGCTGTGGGACCTTGGAGG - Intronic
901078844 1:6572195-6572217 TGTGAGCTGGGGCACCTTCTAGG + Intronic
901216930 1:7560233-7560255 AGTGTGCAGGGGCACCTTAGAGG - Intronic
901229428 1:7633647-7633669 CGTGTGCTGGAGCAGCTTGGCGG + Intronic
901728228 1:11259269-11259291 ATAGTGCTGGAGCTCCTTGGCGG + Exonic
902801661 1:18833991-18834013 AGTGAGCTGGAGAGCTCTGGAGG + Intergenic
909846858 1:80405260-80405282 AGTGTGCTGGAGATACTTGGAGG - Intergenic
910617708 1:89217838-89217860 AGTTAGCTGGAGGACCATGCAGG - Intergenic
915929523 1:160050907-160050929 AGCAGGCTGGAGCACCATGGAGG - Intronic
919067782 1:192714725-192714747 AGTGAGGTAGAGCACCATGCAGG + Intergenic
921441525 1:215191855-215191877 AGTGGGCTGTAGCATCTTGTAGG + Intronic
922408694 1:225346712-225346734 ATTGACTTGGAGCACCTTAGAGG - Intronic
1063953200 10:11243033-11243055 AGTGAGCTGGAGCTTCTTGAGGG - Intronic
1066180911 10:32959279-32959301 GGTGAGCTGCAGCACCCTGTTGG + Intronic
1066402950 10:35092683-35092705 AATGACCAGGAACACCTTGGAGG - Intergenic
1068437912 10:57015738-57015760 TGTGAACTGGAACACCTGGGCGG - Intergenic
1071672534 10:87622419-87622441 AATGGACTGGAGCACCTTGGGGG + Intergenic
1075032421 10:119032810-119032832 ATTGAGCTGGAGCTTCTTGAGGG + Exonic
1075602564 10:123781169-123781191 TGGGAGCTGAAGCACCCTGGCGG + Intronic
1075735044 10:124659471-124659493 CGTGGGCTGGAGCATCTTTGGGG - Intronic
1077516901 11:3007500-3007522 ACAGAGCTCGAGCTCCTTGGTGG - Intronic
1081466708 11:43325977-43325999 AATGAGCAGGAGCACTGTGGCGG - Intronic
1083779769 11:64911820-64911842 GGTGAGTTGGAGCACCCTGGGGG - Exonic
1085386217 11:76159787-76159809 CTAGAGGTGGAGCACCTTGGGGG - Intergenic
1085418678 11:76337192-76337214 AGTGAGCTGCAGAATCTGGGTGG - Intergenic
1086437110 11:86792323-86792345 AGTGAGCATGAGCACCTTGGAGG - Intronic
1088125184 11:106415774-106415796 TGTGAGCAGGAGCACTGTGGGGG + Intergenic
1090656331 11:128848668-128848690 AAGGAGCTGGAGCACCCTAGGGG + Intronic
1092702082 12:11243257-11243279 AGTGACCTGGAACAGCTTTGGGG - Intergenic
1092860498 12:12716130-12716152 TGTGGGCTTGAGCACCGTGGTGG - Intronic
1094763042 12:33557242-33557264 AATGAGCAAGAGCAGCTTGGAGG - Intergenic
1099264937 12:80433914-80433936 AGTTTTCTGGAGGACCTTGGAGG + Intronic
1099712515 12:86245194-86245216 AGGGAGTTGTAGAACCTTGGTGG - Intronic
1100407517 12:94284371-94284393 AATGAGCAAGAGCAGCTTGGAGG + Intronic
1100469109 12:94874019-94874041 ACTGAGCTGGAGAAGCTTTGGGG + Intergenic
1103001370 12:117387737-117387759 ACTGAGCTGGGGCATCTTGAAGG - Intronic
1104749005 12:131226833-131226855 AGTGAGCTGGAGTGGCCTGGGGG - Intergenic
1105911832 13:24875932-24875954 AATGAGCAGGAGCACTGTGGTGG - Intronic
1106587769 13:31072185-31072207 AGTGAGATGGGGCCCATTGGTGG - Intergenic
1106868423 13:33992656-33992678 AGAGAGCAGGAGCAGCTTAGAGG - Intergenic
1107415157 13:40193192-40193214 AGTTATCTGATGCACCTTGGGGG - Intergenic
1113382031 13:109813098-109813120 AGTGGGGTGGAGACCCTTGGTGG + Intergenic
1113765339 13:112877545-112877567 AGAGAGCAGGTGCAGCTTGGGGG + Intronic
1113774963 13:112938826-112938848 GGAGAGCTGGGGCAACTTGGAGG + Intronic
1115282375 14:31678265-31678287 AGTGGGGTGGAGCACCATGTGGG - Intronic
1115850684 14:37587954-37587976 AGCGAGCAGGAGCACCGCGGCGG + Intergenic
1118036296 14:61871527-61871549 AGTGAGCTGGAGCACCCACAGGG + Intergenic
1119544760 14:75463616-75463638 AGTGAGATGGAGGCCCTAGGGGG + Intronic
1121237654 14:92404468-92404490 AGTGTGCTGGAGCACTGTGATGG - Intronic
1122428274 14:101624092-101624114 AGTGAGCTGGACCTTCCTGGTGG - Intergenic
1202833154 14_GL000009v2_random:58131-58153 AGTGAGTCGGGGCACCCTGGAGG + Intergenic
1128544513 15:68558123-68558145 AGTGAGCTGGGCCAGCCTGGCGG + Intergenic
1129385307 15:75192996-75193018 ACTGAGCCGGGTCACCTTGGAGG + Intergenic
1129704547 15:77786788-77786810 AGTGACCTGGAGGGCCCTGGAGG + Intronic
1129892114 15:79078251-79078273 AGGGAGCTGGAGGATCTGGGTGG - Intronic
1130852162 15:87805376-87805398 AGGGAGCAAGAGAACCTTGGTGG + Intergenic
1130899013 15:88193130-88193152 AGTGAGGTGGGGCAGCTGGGTGG - Intronic
1133623811 16:7551362-7551384 AGTGAGCTGGGGCCCCTGGAGGG - Intronic
1136684492 16:31986294-31986316 AGTGAGCTGGAGTATCCAGGAGG - Intergenic
1136785119 16:32929837-32929859 AGTGAGCTGGAGTATCCAGGAGG - Intergenic
1136884664 16:33923967-33923989 AGTGAGCTGGAGTATCCAGGAGG + Intergenic
1138395704 16:56703000-56703022 AGTGAGCTGGGTGACCTTGAGGG + Intronic
1138529779 16:57628675-57628697 AGTGAGCTGGAGAGCGTGGGAGG - Intronic
1138613997 16:58150028-58150050 AGTGAGCAGGAGCATTGTGGTGG - Intergenic
1140649129 16:77067331-77067353 AAGGAGCAGGAGCTCCTTGGTGG + Intergenic
1141342157 16:83213235-83213257 AGAGAGCTTGAGCCACTTGGTGG - Intronic
1203087779 16_KI270728v1_random:1193846-1193868 AGTGAGCTGGAGTATCCAGGAGG - Intergenic
1146607305 17:34271654-34271676 AGTCAGATGGAACACCTTGAGGG - Intronic
1148393464 17:47290237-47290259 AATGAGCTGGAGGACATTGCTGG - Exonic
1148616057 17:48999878-48999900 TGTGAGCTGGGGCTCTTTGGAGG + Intronic
1149555225 17:57568837-57568859 AGGGGGCTGGAGCACTGTGGTGG + Intronic
1150461500 17:65357274-65357296 AGTGAGCTGGAGCAAGGTGCAGG + Intergenic
1152303145 17:79507018-79507040 AGGCAGCTGGAGCCCGTTGGTGG + Intronic
1152819509 17:82429586-82429608 AGTGACCTGGAGGACCCTGGCGG - Intronic
1153558184 18:6340377-6340399 ACTGAGCTGTGCCACCTTGGGGG - Intronic
1154121528 18:11656294-11656316 AGTGGGCCTGAGCCCCTTGGGGG - Intergenic
1157207340 18:45711788-45711810 AGTGAGCTGCCGCACCTAGCCGG + Intergenic
1157311541 18:46556913-46556935 GGTGAGCTGGATGACATTGGAGG - Intronic
1159747047 18:72249839-72249861 ATTGAGTTGGAGCACAATGGGGG + Intergenic
1162569010 19:11460096-11460118 AGTGAGTTGGGGCAGATTGGAGG - Intronic
1163574246 19:18101292-18101314 AGAAAGCAGGATCACCTTGGAGG - Intronic
1163646680 19:18493505-18493527 AGTGAGCTGCCGCACTTGGGAGG + Intronic
1163651171 19:18518878-18518900 AGCCAGCTGGAGCAGCGTGGTGG - Intronic
1164311237 19:24048273-24048295 ACTGAGGTGGGCCACCTTGGGGG + Intronic
1165431645 19:35776329-35776351 AATGAGCGGGAGCAGCATGGTGG - Intronic
1166751433 19:45165587-45165609 GGTCACCTGGAGCATCTTGGTGG - Intronic
1168615307 19:57832796-57832818 AGAGAGCTGTACCACCTTTGTGG + Intronic
1202639516 1_KI270706v1_random:69579-69601 AGTGAGTTGGGGCACCCTGGAGG - Intergenic
924991146 2:314228-314250 GGCGAGCTGGAGCACCTGTGTGG + Intergenic
926797089 2:16627953-16627975 AGAGAGATGGAGCAGCTGGGCGG + Intronic
926801593 2:16665032-16665054 AGCGAGTAGGAGCAGCTTGGAGG + Intronic
928219185 2:29388963-29388985 AGTGAGATGGAGGCCTTTGGAGG - Intronic
928587321 2:32773637-32773659 AGTGAGATTGACCACCTTGCAGG + Intronic
928854523 2:35788598-35788620 TTTGAGCTGGAGCACCCAGGTGG - Intergenic
930026060 2:47029817-47029839 AAGGAGCAGGACCACCTTGGAGG - Intronic
931218767 2:60270292-60270314 AAGGAGCTGGGGCACATTGGTGG - Intergenic
932955056 2:76342251-76342273 GGAGAGCTGGATGACCTTGGTGG - Intergenic
933090447 2:78110550-78110572 ATTGAGCTACAGCACCTGGGTGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933278477 2:80306563-80306585 AGTGTTCCGCAGCACCTTGGAGG - Intronic
934133545 2:88972100-88972122 TGTGACCTGGATCACCTGGGAGG - Intergenic
934159130 2:89231339-89231361 TGTGACCTGGAGCACCCAGGAGG - Intergenic
934167478 2:89307340-89307362 TGTGACCTGGAGCACCTGGGAGG - Intergenic
934199797 2:89875106-89875128 TGTGACCTGGAGCACCTGGGAGG + Intergenic
934208142 2:89951086-89951108 TGTGACCTGGAGCACCCAGGAGG + Intergenic
936009599 2:108916969-108916991 AGTGAGCTGCTGCCCTTTGGTGG - Intronic
937302875 2:120853908-120853930 TATGAGATGGAGCAGCTTGGGGG + Intronic
941303472 2:163831177-163831199 AGGGAGGTGGAGCAACATGGGGG - Intergenic
947932407 2:233974625-233974647 AGGCAGCTGGACCACCTGGGAGG + Intronic
948161962 2:235832309-235832331 AATAAGCTGGAGAACCTTGAAGG - Intronic
948370037 2:237483094-237483116 AGAGAGCTGGAGCACCTGAGAGG + Intergenic
1168843016 20:921773-921795 TGTCAGCTGGAGCAACTTGCAGG + Intergenic
1170178671 20:13502924-13502946 ACTGAGCTGTGCCACCTTGGGGG - Intronic
1170441924 20:16387771-16387793 GGTGGTCTGGAGCAGCTTGGAGG + Intronic
1170722836 20:18899589-18899611 AGAGAGGTGGAGCAACTTGTCGG + Intergenic
1172788807 20:37488118-37488140 AGTGAGTTGGAGCACCCAAGGGG - Intergenic
1174086623 20:48013349-48013371 AGTGAGGTGGAGAATCCTGGGGG + Intergenic
1176389490 21:6156307-6156329 TGTGAGCTGGAGCCCATAGGAGG + Intergenic
1176647846 21:9367178-9367200 AGTGAGTCGGGGCACCCTGGAGG - Intergenic
1178381383 21:32112544-32112566 AATGATCTGGAGCACCCTGGAGG + Intergenic
1179253859 21:39698278-39698300 AGTGAGTTGGAGGAACTTGCAGG + Intergenic
1179733978 21:43381931-43381953 TGTGAGCTGGAGCCCATAGGAGG - Intergenic
1180362426 22:11912291-11912313 AGTGAGTTGGGGCACCCTGGAGG + Intergenic
1181470885 22:23138860-23138882 CGTGATGTGGAGCACCTCGGTGG + Exonic
1182307768 22:29382884-29382906 AGTGAGCTGGAGCCACTGGAGGG + Intronic
1183117981 22:35706508-35706530 ACAGAGCTGCACCACCTTGGGGG - Intergenic
1183369630 22:37425230-37425252 AGGGGGCTGCAGCACATTGGAGG + Intronic
1184841644 22:47055683-47055705 AGTGGGCAGGCGCACCTAGGAGG + Intronic
953055869 3:39386825-39386847 ACTGGGATGGGGCACCTTGGAGG + Intronic
954197400 3:49004854-49004876 AGTGAGGCGCAGCACCCTGGTGG - Exonic
958615956 3:96493871-96493893 AGTGGGCTGGTGCACATTGGCGG + Intergenic
960961501 3:123073496-123073518 AGTGAACTGGAGCTCCTTGGGGG - Intronic
961432002 3:126890084-126890106 AGTGAGCTGGAGCACCTTGGGGG - Intronic
966375619 3:179292441-179292463 ACTCTGCTGGAGCACCTTTGTGG - Intergenic
1202739038 3_GL000221v1_random:37809-37831 AGTGAGTCGGGGCACCCTGGAGG + Intergenic
971537203 4:27768136-27768158 AGTGAGCCAGAGATCCTTGGAGG + Intergenic
971556035 4:28013989-28014011 CGTGAGCTGGAGCATCCAGGTGG + Intergenic
973875832 4:55217513-55217535 GGAGAGCTGGAGGACTTTGGAGG - Intergenic
974402799 4:61426736-61426758 TTTGAGCTGGAGCATCCTGGTGG + Intronic
974433996 4:61833863-61833885 AGTGAACAGGAGCAGTTTGGAGG + Intronic
976812002 4:89108400-89108422 AGAGAGCTGGGCCACCTTGCAGG + Intronic
978287415 4:107095128-107095150 AGGGAGATGGAGAACCCTGGGGG + Intronic
982523621 4:156450912-156450934 AGTCAGATGGAGCACCAGGGAGG - Intergenic
983017245 4:162628518-162628540 AGTGAGGTAGAGCACCATGTGGG + Intergenic
985263802 4:188139720-188139742 TGAGTGCTGGAGGACCTTGGAGG + Exonic
1202766876 4_GL000008v2_random:155434-155456 AGTGAGTCGGGGCACCCTGGAGG - Intergenic
986594623 5:9408309-9408331 TGTGAGCTGGAGTGCCTTAGTGG - Intronic
987507573 5:18793323-18793345 TTTGAGCTGGAGCACCAGGGAGG - Intergenic
989255617 5:39363134-39363156 AGGGAGCTAAAGCAACTTGGAGG + Intronic
991651830 5:68863435-68863457 TGGGAGATGGAGCAGCTTGGAGG + Intergenic
994722944 5:103401582-103401604 AGTGAGGTGCAGCACCTTCCTGG - Intergenic
994981042 5:106875460-106875482 TTTGAGCTGAAGCACCTGGGCGG + Intergenic
995749703 5:115441305-115441327 AGTGAGCTGGAGATCCTCTGTGG - Intergenic
996801924 5:127413753-127413775 AGGAAGCTAGAGCACTTTGGAGG - Intronic
997395614 5:133557591-133557613 AGTGAGCTTTAGCACTTTTGTGG + Intronic
997714126 5:136029364-136029386 AGGGAGGTGGAGGACCATGGAGG + Intronic
1001771748 5:174302139-174302161 AGTCAGCAGGACCACCTTGCTGG - Intergenic
1001988116 5:176093158-176093180 AGTGACCGTCAGCACCTTGGTGG - Intronic
1001989324 5:176103190-176103212 AGTGACCATCAGCACCTTGGTGG - Intronic
1002227546 5:177734948-177734970 AGTGACCATCAGCACCTTGGTGG + Intronic
1002228752 5:177744982-177745004 AGTGACCGTCAGCACCTTGGTGG + Intronic
1002266594 5:178038801-178038823 AGTGACCGTCAGCACCTTGGTGG - Intronic
1003270416 6:4602996-4603018 AGGGCGCTGGGGCACCTTGAGGG + Intergenic
1003395611 6:5749885-5749907 GGCCAGCTGGAGCACCTTCGTGG - Intronic
1004743515 6:18487241-18487263 GGTGAGCTGGAGGTCCTTGCAGG + Intergenic
1006147435 6:31968010-31968032 ATTCACCCGGAGCACCTTGGTGG - Exonic
1006392997 6:33769858-33769880 GGTGGCCTGGAGCTCCTTGGTGG + Intergenic
1006557532 6:34881017-34881039 AGTGAACTGGAACACCTTTTTGG + Intronic
1006614575 6:35317810-35317832 CTTGAGCTGGAGCACCCTTGGGG + Intronic
1007556116 6:42767930-42767952 AGTGGTCTGGAGCAGCATGGAGG + Intronic
1008704224 6:54138072-54138094 ACTGAGCTGGGGCACCAGGGTGG - Exonic
1008716500 6:54295656-54295678 AGTGGGCTGGTGCACATAGGTGG + Intergenic
1011094059 6:83638114-83638136 AGCAAGATGGAGCGCCTTGGGGG + Intronic
1011528045 6:88287839-88287861 ACTGAGCTGGACTGCCTTGGGGG + Intergenic
1014737737 6:125113573-125113595 GGTGAGCTGGAGAACCCTAGTGG - Intergenic
1014752339 6:125269511-125269533 CTTGAGTTGGAGCACCTGGGCGG - Intronic
1014894008 6:126877653-126877675 ACTGAGCTGTGACACCTTGGGGG + Intergenic
1018030004 6:159834275-159834297 AGGGATCTGAAGCACCTTTGGGG - Intergenic
1018262547 6:161984872-161984894 AGTGAGCAGGAGGACCCTGCTGG + Intronic
1019863533 7:3683598-3683620 TGTGAGGTGGAGGACCTGGGAGG - Intronic
1022302587 7:29115063-29115085 AGAGAGATGGAGCAACTTGCTGG - Intronic
1022949509 7:35322511-35322533 AGTGAGCTGGCCCACCCTGGAGG - Intergenic
1023905518 7:44519173-44519195 CGTGAGCTGCAGCACCTAGCTGG + Intronic
1026377692 7:69768578-69768600 AGTGAGCAGGAAAACCTTGTGGG + Intronic
1027891237 7:83978333-83978355 TGTGAGCTGCAGCACGTTGTGGG + Intronic
1033636475 7:143216417-143216439 TGTGAGCTGGATCTCCTTGTAGG - Intergenic
1033929955 7:146508697-146508719 CTTGAGCTGGAGCATCTGGGTGG + Intronic
1034244190 7:149632126-149632148 AGTGAAGTGGAGCACTTGGGTGG - Intergenic
1034481141 7:151321125-151321147 AGGGAGCTGAGGCAGCTTGGGGG - Intergenic
1034571286 7:151958609-151958631 AGTGGGCTGGAGCAGGATGGTGG - Intronic
1037795148 8:21987134-21987156 CATCAGCTGGAGCACCCTGGAGG - Exonic
1037897171 8:22665657-22665679 AGAGAGCAGGAGAAGCTTGGAGG + Intronic
1038286894 8:26213269-26213291 AGTGAGCTGGAGGACCCGGGTGG - Intergenic
1048008348 8:130437293-130437315 TGTGAGCTGGGGCATCTTGAAGG - Intronic
1053006353 9:34607446-34607468 AGTGATGTGGAGGACCCTGGGGG - Intergenic
1053504513 9:38630027-38630049 ATTGCGCTGGACCATCTTGGTGG + Intergenic
1055659859 9:78491945-78491967 ATTGAGCTGGGGCACATTTGTGG + Intergenic
1056724718 9:89104681-89104703 AGGTAGCAGGACCACCTTGGGGG + Intronic
1057169521 9:92952851-92952873 GCTGAGCTGGAGGACCTCGGGGG - Intronic
1057917199 9:99065885-99065907 AGTGACCAGGATCACCATGGTGG - Intronic
1060793836 9:126501999-126502021 CATGAGCTGCAGCTCCTTGGGGG - Intronic
1061083574 9:128386354-128386376 AGTGAGCTGCAGCTAGTTGGAGG + Intronic
1061456485 9:130701806-130701828 AGTGAGCTGGAGCCTCCTGCTGG - Intronic
1061865164 9:133488271-133488293 AGGGAGCAGGGGCCCCTTGGGGG + Intergenic
1062294468 9:135816833-135816855 GGTGAGCAGGAGCTCCATGGTGG + Intronic
1203707767 Un_KI270742v1:68253-68275 AGTGAGTCGGGGCACCCTGGAGG + Intergenic
1203547624 Un_KI270743v1:140311-140333 AGTGAGTCGGGGCACCCTGGAGG - Intergenic
1186189766 X:7057026-7057048 AGGGAGGTGAAGCACCTTGGCGG + Intronic
1190287465 X:48970903-48970925 AGGGAGCTGGTGCATCTTGAGGG + Exonic
1192101790 X:68272011-68272033 AGGGAGCTGGAGGACGTTGCAGG - Intronic
1194774359 X:97944433-97944455 AGTGGGCTGGTCCACATTGGTGG - Intergenic
1196530858 X:116784639-116784661 AGTGAGCTGCCGCACCTGGCTGG - Intergenic
1198092792 X:133348482-133348504 AGTGTGCTGGGGGACCTTGCGGG + Intronic