ID: 961432763

View in Genome Browser
Species Human (GRCh38)
Location 3:126894683-126894705
Sequence CAGCAGACGGAGCAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 637
Summary {0: 1, 1: 1, 2: 5, 3: 57, 4: 573}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961432751_961432763 29 Left 961432751 3:126894631-126894653 CCAGTGTGAGCACACACCCATCA 0: 1
1: 0
2: 0
3: 20
4: 228
Right 961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG 0: 1
1: 1
2: 5
3: 57
4: 573
961432757_961432763 12 Left 961432757 3:126894648-126894670 CCATCACGGTGGGAGGCAGACTG 0: 1
1: 0
2: 3
3: 17
4: 198
Right 961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG 0: 1
1: 1
2: 5
3: 57
4: 573
961432756_961432763 13 Left 961432756 3:126894647-126894669 CCCATCACGGTGGGAGGCAGACT 0: 1
1: 0
2: 0
3: 25
4: 635
Right 961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG 0: 1
1: 1
2: 5
3: 57
4: 573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961432763 Original CRISPR CAGCAGACGGAGCAGGAGGC TGG Intronic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900020918 1:186316-186338 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900199724 1:1399022-1399044 CGGCAGGCGGAGCAGGATACCGG + Exonic
900346340 1:2212287-2212309 CAGGATCCGGAGCAGGAGGGTGG + Intronic
900395698 1:2452426-2452448 CAGGAGGGAGAGCAGGAGGCAGG - Intronic
900424153 1:2568444-2568466 AAGCAGACGGACGGGGAGGCGGG - Intergenic
900779572 1:4609022-4609044 CAGCAGAGGGAGCAGCAAGGGGG - Intergenic
900875128 1:5337045-5337067 CAACAGACGGAGGCGGAGGCAGG + Intergenic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901022111 1:6260861-6260883 CCGCAGCCGGAGCCGGAGGCGGG - Exonic
901332783 1:8423763-8423785 CCGCTGACGGGGGAGGAGGCAGG + Intronic
901604731 1:10450237-10450259 GAGCAGCAGCAGCAGGAGGCCGG - Exonic
901783329 1:11608840-11608862 CCGCACTCGGAGCAGCAGGCCGG + Intergenic
902081016 1:13820735-13820757 CAGCAGCAGGAGCTGGGGGCTGG - Intronic
902407316 1:16191829-16191851 CCGCAGAAGGAGGAGGAAGCTGG - Intergenic
902437608 1:16408574-16408596 CAGAAGACCTAGCACGAGGCTGG + Intronic
902546519 1:17193842-17193864 CAGAAAAGAGAGCAGGAGGCAGG + Intergenic
902876478 1:19343691-19343713 CGGCGGACAGAGCAGGAGGCAGG - Intronic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
904045103 1:27603965-27603987 CAGCGGAGAGAGCAGAAGGCAGG - Intronic
904241473 1:29148979-29149001 CAAAAGTCGGAGCAGGAGTCAGG - Exonic
904360565 1:29968714-29968736 AAGCAGAGGCAGCAGGAGGTGGG + Intergenic
904684197 1:32248762-32248784 CAGCAGAGGAAACAGGATGCTGG - Exonic
905034258 1:34906970-34906992 CAGCAGATGGCCCAGGAGCCTGG - Intronic
905289615 1:36912422-36912444 CAGCAGAGGGGGGAGGAGGGGGG - Intronic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
906040508 1:42785013-42785035 CAGGAAACGGGGCAGGAGGGCGG + Intronic
906617174 1:47241387-47241409 CAGGAGAAGGAGCTGGAGGAAGG - Intergenic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906704110 1:47882224-47882246 CAGCATGGGGAGCATGAGGCAGG - Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
908028182 1:59972546-59972568 CAGCAGAAGGTGCAGCTGGCGGG + Intergenic
908238418 1:62169131-62169153 CACCAGAGGGGGCGGGAGGCTGG - Intergenic
911568903 1:99498440-99498462 CAGCAGCTGGAGCAGAAGGAAGG + Intergenic
912498919 1:110108954-110108976 CTGCAGAGGGAGCAGGGGGATGG - Intergenic
912580290 1:110714785-110714807 CAGCTGATGATGCAGGAGGCAGG + Intergenic
912776569 1:112509387-112509409 CAGCAGCAGGAGCAGAAGGCAGG - Exonic
913566774 1:120080401-120080423 CAAGAGACGGAGCAAGAGGGGGG - Intergenic
914932742 1:151949472-151949494 CAGCCACAGGAGCAGGAGGCTGG + Intergenic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915165532 1:153946096-153946118 CAGAAGGGGGTGCAGGAGGCCGG + Intronic
915512718 1:156395181-156395203 CAGCTGGCCCAGCAGGAGGCAGG + Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
920047070 1:203140245-203140267 CAGCAGGCGGGGCTTGAGGCAGG + Intronic
920062086 1:203233934-203233956 GAGGAGATGGAGCAGGAGGCAGG - Intronic
920265115 1:204715803-204715825 TAGCAGGCAGAGCAGGAGGCAGG + Intergenic
920294502 1:204947556-204947578 CAGCAGTGGGAGCTGGAGGCTGG - Intronic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
920743241 1:208600952-208600974 CAGCTGATGATGCAGGAGGCTGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
923552972 1:234978914-234978936 AAGCAGAGGCAGCAGGGGGCAGG + Intergenic
923772106 1:236946581-236946603 GGGCAGATGGGGCAGGAGGCTGG + Intergenic
924714765 1:246563013-246563035 CAGCTGAGGGACCAGGAAGCGGG - Intronic
924944615 1:248838119-248838141 CAACAGACAAAGCGGGAGGCAGG + Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063470319 10:6279551-6279573 CAGCAAACACAGCAGGAAGCAGG - Intergenic
1063475571 10:6325895-6325917 CGGCAGAAGGAGCATGAGGAAGG - Intergenic
1064131823 10:12716435-12716457 CACTAGACGGAACAGTAGGCAGG - Intronic
1064412523 10:15119600-15119622 CAGCAGAATGAGCAGCACGCGGG + Intronic
1064562275 10:16605003-16605025 CAGCAGACAAAGCAGGAGTGAGG + Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065373877 10:25016990-25017012 CAGCAGGCGGAGGAGGCCGCGGG - Intronic
1065382220 10:25101961-25101983 CAGGAGATGGAGCTGAAGGCAGG + Intergenic
1065739580 10:28784768-28784790 ATGCAGACTGAGAAGGAGGCAGG - Intergenic
1065819548 10:29512800-29512822 AAACAGACTCAGCAGGAGGCAGG - Exonic
1065953307 10:30671605-30671627 AAACAGACTCAGCAGGAGGCAGG + Intergenic
1066638998 10:37536814-37536836 CAGCATACTGAGCTGGAGGTGGG - Intergenic
1066657270 10:37708016-37708038 CAGCAGATGGAGCTGGAGACAGG - Intergenic
1067111971 10:43407555-43407577 CAGCCGGCGCAGCAGGAGCCGGG + Intronic
1067696918 10:48542485-48542507 AGGCAGAGGCAGCAGGAGGCAGG - Intronic
1067945141 10:50684456-50684478 CAGGAGCTGGAGCAGGAGGAAGG + Intergenic
1068544062 10:58326964-58326986 CAGGATACGGAGCAGGCAGCAGG - Intergenic
1069539871 10:69285903-69285925 CAGGAGACGGAGTAGGAGGAGGG - Intronic
1069881931 10:71598566-71598588 CAGCTGATGGGGAAGGAGGCAGG + Intronic
1070312579 10:75284353-75284375 CAGAAGAGGGAGCAGCAGGCGGG + Intergenic
1071633558 10:87233551-87233573 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071647005 10:87365767-87365789 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1071855027 10:89615430-89615452 CAGGAGATGAAGCAGGAGGAAGG - Intronic
1072543217 10:96414137-96414159 CAGCAGACAAGGCAGCAGGCGGG - Intronic
1072547091 10:96448162-96448184 CAGCGGAACGAGCAGGATGCAGG - Intronic
1072930763 10:99659755-99659777 GAGCAGACGGAGCGGGAGCCTGG + Intronic
1073045285 10:100634186-100634208 CAGCAGCCAGAGCAGGAGGGTGG - Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075444597 10:122504694-122504716 GTGCAGGCGGGGCAGGAGGCAGG - Intronic
1076053009 10:127350276-127350298 GAGCAGAGGCTGCAGGAGGCAGG - Intronic
1076490817 10:130860136-130860158 CTTCAGAGGGTGCAGGAGGCTGG - Intergenic
1076494497 10:130888080-130888102 ACGCAGATGGAGGAGGAGGCAGG + Intergenic
1076773386 10:132679386-132679408 CAGCCGCCGGGCCAGGAGGCTGG + Intronic
1076984223 11:223699-223721 CAGCAGCCTGTGCAGGAGACAGG - Intronic
1077076199 11:703297-703319 CAGGAGTGGGAGCAGGAGCCAGG + Exonic
1077192858 11:1262738-1262760 CAGGAGGCGGGACAGGAGGCGGG - Intergenic
1077192862 11:1262750-1262772 CAGGAGGCGGGACAGGAGGCGGG - Intergenic
1077407612 11:2389624-2389646 CAGCAGCTGGGGCAGGAAGCAGG - Intronic
1077506825 11:2933447-2933469 CAGCAGCTGGAGTAGGATGCGGG + Intergenic
1077518783 11:3018803-3018825 CAGCAGACAGTGCAGGTGGCAGG - Intronic
1077912665 11:6586903-6586925 GAGCCGAGGCAGCAGGAGGCTGG - Intronic
1079084150 11:17433313-17433335 AAGCAGAGGGACCAGGAGTCAGG + Intronic
1079128494 11:17734811-17734833 CAGCAAGCGGAGCAGCAGCCCGG + Exonic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1079212817 11:18478316-18478338 CAGCAAACATGGCAGGAGGCTGG + Intronic
1079392703 11:20036217-20036239 GAGCAGAGGCGGCAGGAGGCTGG - Intronic
1080433743 11:32221270-32221292 CAGCAGCAGGAGCAGAAGACAGG - Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1083678954 11:64342595-64342617 CTGCAGGCGGGGCAGGCGGCCGG - Exonic
1083709510 11:64539376-64539398 AACCAGAGGCAGCAGGAGGCTGG + Intergenic
1083773933 11:64884011-64884033 CAGCAGAGGGGACAGGAGGGTGG - Intronic
1083796879 11:65021967-65021989 CAGCAGTAGCAGCAGCAGGCTGG - Exonic
1084014254 11:66369333-66369355 CGGCAGAGGGCGCAGGAGCCAGG + Intronic
1084139469 11:67215460-67215482 CAGCACACGGAGGAAGATGCAGG - Intronic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084410360 11:69003083-69003105 GAGCAGACACACCAGGAGGCAGG - Intergenic
1084454606 11:69261219-69261241 CAGGAGATGGGGCAGGAGACTGG - Intergenic
1084658431 11:70533063-70533085 AAGCAGACGTTGCCGGAGGCTGG + Intronic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1086123839 11:83329040-83329062 CAGAAGACAGATCAGGATGCTGG + Intergenic
1088822576 11:113469195-113469217 AAGCAGTGGGAGCAGGAGGGAGG - Intronic
1089046321 11:115504308-115504330 CAGAAGCCGGAGCCGGAGCCCGG + Exonic
1089461815 11:118658298-118658320 CAGGAGGCTGAGCAGGAGGCTGG + Exonic
1089466191 11:118688042-118688064 CAGAAGGCTGAGCAGGAGGCTGG + Intergenic
1089645296 11:119874878-119874900 CAGCAGAAGGGGCCGGAAGCTGG - Intergenic
1089693077 11:120198665-120198687 CAGGAGACAGAGCAGTAGGGTGG + Intergenic
1090846199 11:130532120-130532142 AAGGAGACAGAGCCGGAGGCAGG - Intergenic
1091094759 11:132810143-132810165 CAGAAGACGGAGGGAGAGGCTGG - Intronic
1091237643 11:134032762-134032784 AGGCAGACGGAGCAGGTGGGCGG - Intergenic
1091374293 12:15912-15934 AAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1091410387 12:235267-235289 AAGCAGCAGGGGCAGGAGGCAGG + Intronic
1091473447 12:751405-751427 CACCAGACCGAGTAGGAAGCCGG - Intergenic
1092100444 12:5879231-5879253 CAGCAGATGAAGCCGCAGGCAGG + Intronic
1092163391 12:6328275-6328297 CCCCAAACAGAGCAGGAGGCAGG - Exonic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092732458 12:11547375-11547397 CAGCACTCGGAGCGGCAGGCCGG + Intergenic
1092939053 12:13390520-13390542 GAGCAGAGGGAGCAGGTGCCTGG + Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1093970198 12:25369449-25369471 CCGCACTCGGAGCAGGCGGCCGG + Intergenic
1095634069 12:44410678-44410700 CAGGAGACTGATCAGGAGACTGG + Intergenic
1096323857 12:50640758-50640780 CTGCAGATGGAGCAGGTGTCTGG - Exonic
1096593217 12:52676135-52676157 AAGTACACGGAGCAGGAGGAAGG - Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096735387 12:53649306-53649328 CAGAAGACTCAGCAAGAGGCTGG + Intronic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1096786382 12:54019292-54019314 CGGCAGCCTGAGCAGGCGGCGGG - Intronic
1097017941 12:56000421-56000443 CCGCACACGGAGCAGCCGGCTGG - Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1101852709 12:108417063-108417085 CAAAAGCAGGAGCAGGAGGCAGG + Intergenic
1101875116 12:108592342-108592364 CAACAGAAGGATGAGGAGGCTGG + Exonic
1102113991 12:110387123-110387145 CAGGAGGCTGAGCAGGAGGATGG + Intronic
1102229898 12:111255422-111255444 CAGCAGACACACCTGGAGGCAGG + Intronic
1102555712 12:113725234-113725256 GAGCAGACGGAGCCGGCAGCTGG + Intergenic
1103057770 12:117835190-117835212 CAGCAGACGGAGCTCAGGGCTGG - Intronic
1103185261 12:118951319-118951341 CAGTAGACAGAGCATGAGGGTGG - Intergenic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103916191 12:124376829-124376851 CCCCAGACGGGGCAGGAGGAAGG + Intronic
1103944756 12:124519847-124519869 ACACAGACAGAGCAGGAGGCTGG + Intronic
1103954964 12:124571006-124571028 CAACAGAGGGGGAAGGAGGCAGG + Intergenic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104040525 12:125127245-125127267 CAGCAGAGTGAGCAGCAGGAAGG + Intronic
1106333016 13:28756483-28756505 CAGCAGAGGAAAGAGGAGGCTGG + Intergenic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1106798724 13:33233866-33233888 CAGCAGCCGGAGCAGCCAGCCGG + Intronic
1106833940 13:33613909-33613931 CAACAGTGGGAGCAGAAGGCAGG + Intergenic
1107588508 13:41879302-41879324 CAGCAGAAAGAGGAGGAGGGTGG - Intronic
1107769582 13:43775680-43775702 AAGCAGAGAGAGCAGGAAGCTGG - Intronic
1107975462 13:45683968-45683990 CAGCAGAGGGAGCAGCAGCAGGG - Intergenic
1110732321 13:78893417-78893439 CAGCAGACAGATCAGGAGGGTGG - Intergenic
1110757115 13:79188465-79188487 CAGCAGAGAGAGCAGGTGTCTGG + Intergenic
1111042512 13:82767927-82767949 CAGCAGACGGGGCGTGAGTCTGG - Intergenic
1113059250 13:106303501-106303523 CAGAAGACTGAGCAGGTGGAGGG + Intergenic
1113274651 13:108715197-108715219 GAGCACACGGAGCAGGAGCACGG - Intronic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1115531165 14:34328500-34328522 CAGCAGAAGGAGCAGCAGCTGGG + Intronic
1117650904 14:57904296-57904318 CAACAGACCGAGCAGGAGAGAGG - Intronic
1117997980 14:61496082-61496104 CAGCAGAGGGACCAGTGGGCTGG + Intronic
1118973736 14:70659524-70659546 AAGCAGCCGCAGCAGGAGGAGGG + Intronic
1119196098 14:72717762-72717784 CAGCAGAAGGAGCAGGACCTAGG + Intronic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122082509 14:99275070-99275092 CAGCAGGCGGGGCGGGAGGGGGG + Intergenic
1122342189 14:101035641-101035663 CAGCTGTGGGAGCAGAAGGCAGG + Intergenic
1122836037 14:104431597-104431619 CAGCAGACGCAGCCTGAGGTGGG - Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123008981 14:105338165-105338187 CAGCAGGCGGAAGGGGAGGCTGG - Intronic
1123213649 14:106785353-106785375 CTGCAGGCCCAGCAGGAGGCCGG - Intergenic
1124051284 15:26199343-26199365 CAGCAGAGGAAGGGGGAGGCAGG - Intergenic
1124177320 15:27438634-27438656 CACCCGGAGGAGCAGGAGGCGGG - Intronic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124635955 15:31365432-31365454 GAGAAGACCCAGCAGGAGGCCGG + Intronic
1125605929 15:40939885-40939907 CAGGAGACAGGGCAGGAGGGAGG + Intergenic
1127314943 15:57785978-57786000 CAGGAGAAGGAGCAGGTGACGGG - Intergenic
1127860257 15:62988147-62988169 GATCTGACGGAGCTGGAGGCAGG + Intergenic
1127976706 15:64002871-64002893 CAGCAGAGGGAGGAGGAGAGAGG + Intronic
1128018988 15:64373723-64373745 CAGCACACTGAGCAGCAAGCTGG - Intronic
1128153505 15:65377714-65377736 CAGCAGCGGCAGCAGGAGCCGGG + Exonic
1128417454 15:67459661-67459683 CAGCAGACAGGGCAGGAGTCAGG - Intronic
1128563993 15:68687260-68687282 GAACAGACTGAGCAGGAGGTAGG - Intronic
1128983546 15:72202963-72202985 GAGCAGGTGGAGCAAGAGGCTGG + Intronic
1129220871 15:74131007-74131029 AAGTAGACCAAGCAGGAGGCGGG + Intronic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129232255 15:74203318-74203340 CTCCAGGAGGAGCAGGAGGCAGG - Intronic
1130963492 15:88680719-88680741 CAGGAGACGGAGGGGCAGGCAGG + Intergenic
1131251945 15:90836783-90836805 CAGTGGACGGGGCAGGAGTCAGG - Intergenic
1132311764 15:100862452-100862474 CTGCACACTGGGCAGGAGGCAGG + Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1132530947 16:449140-449162 GAGCAGAGTGAGCAGGGGGCCGG - Intronic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134849504 16:17469442-17469464 GAGCACATGGGGCAGGAGGCCGG - Intronic
1135234393 16:20741936-20741958 CGGGAGGCGGGGCAGGAGGCGGG - Exonic
1135254953 16:20933686-20933708 CAGCATACTGACCAGGAGTCAGG - Intronic
1135908141 16:26532836-26532858 AAGCAGATTTAGCAGGAGGCTGG - Intergenic
1135990537 16:27216224-27216246 CAGCTGTCGGAGCGGGTGGCTGG + Intronic
1136136474 16:28259432-28259454 AAGCAGACGAAGCAGAAGGCCGG - Intergenic
1136234104 16:28903944-28903966 CAGCAGACGGGCCCAGAGGCTGG - Intronic
1136599487 16:31275320-31275342 CAGCAGATGGATCAGCAGCCGGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138094283 16:54199951-54199973 CAGCTGACAGAGCAGGGGCCGGG + Intergenic
1139160283 16:64497860-64497882 TAGTAGACAGAGCAGGAGCCTGG + Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1141703098 16:85651377-85651399 CAGCAGGCGGGGCAGGGGCCCGG - Intronic
1141779669 16:86151199-86151221 CAGCAGGAGGAGGTGGAGGCTGG - Intergenic
1142027786 16:87823801-87823823 CAGCAGCCAGAGGAGGAGGCCGG - Intergenic
1142200292 16:88757870-88757892 CAGCAGATGCCCCAGGAGGCAGG + Intronic
1142582302 17:949696-949718 CAGCAGGGAGAGGAGGAGGCAGG - Intronic
1142712356 17:1730449-1730471 CAGCAGGCGGAGCAGGTTCCGGG - Exonic
1143247640 17:5500037-5500059 CAGCAGGCGAAGCTGGAGGGCGG - Intronic
1143283873 17:5774682-5774704 CAGCAGTGGGAGGTGGAGGCTGG - Intronic
1143303506 17:5928292-5928314 CAGAAGCCTGAGCAGCAGGCTGG + Intronic
1143319674 17:6059947-6059969 CACGAGTCGGGGCAGGAGGCTGG - Intronic
1143527192 17:7479527-7479549 CCGGAGCCGGAGCTGGAGGCGGG - Intronic
1143532761 17:7514663-7514685 CAGCAGCCCAGGCAGGAGGCAGG - Intergenic
1144586586 17:16491459-16491481 CCGCAGGCAGAGAAGGAGGCTGG - Intronic
1145846333 17:28041969-28041991 CAGCAGAAGCAGCCGGCGGCGGG + Intronic
1145988854 17:29066013-29066035 CCCCAAACTGAGCAGGAGGCCGG - Intergenic
1146916856 17:36683481-36683503 CAGATTACAGAGCAGGAGGCTGG - Intergenic
1147416619 17:40295904-40295926 CAGCAGGAGGGGCAGGAGGATGG - Intronic
1147507103 17:41029729-41029751 CAGCAGTGGCAGCAGCAGGCTGG + Exonic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1147911342 17:43858034-43858056 CAGCAGAGGGAGGAGGGGCCAGG - Intronic
1148021692 17:44557711-44557733 CAGCAGCGGCAGCAGCAGGCGGG - Exonic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148334728 17:46833566-46833588 CACCACACTGAGCAGGAGACTGG - Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148861125 17:50604811-50604833 CAGCAGACGCCTCAGGGGGCCGG + Intronic
1149596666 17:57868342-57868364 CCGGAGAGGGAGCAGGGGGCAGG + Intronic
1150045060 17:61904518-61904540 CAGCTGGCGTAGCAGGAGGACGG + Exonic
1150810400 17:68351972-68351994 CAGCAGGCAGAGGAGGAGGGAGG - Intronic
1151416365 17:73968573-73968595 GAGCAGAGAGAGCAGGAGGCAGG + Intergenic
1151817958 17:76480790-76480812 CAGAAGACACAGCAGCAGGCAGG - Intronic
1151831298 17:76553405-76553427 CACCAGACGGAGGAAGAGACTGG + Intronic
1152289240 17:79429457-79429479 CAGCAGGCTGGGCAGGAGGAGGG + Intronic
1152516120 17:80825914-80825936 AAGTAGACGGAGACGGAGGCTGG + Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152856488 17:82667605-82667627 CAGGAGACAGAGGAGGATGCGGG - Intronic
1152922303 17:83072245-83072267 CAGGAGTCAGGGCAGGAGGCTGG - Intergenic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1154355288 18:13619876-13619898 GAGCAGACTGTGTAGGAGGCTGG - Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157190913 18:45580942-45580964 AACCAGGCTGAGCAGGAGGCAGG + Intronic
1157568646 18:48697660-48697682 CAGCAGAAGGAGCACTGGGCTGG - Intronic
1157799166 18:50604984-50605006 GAGCAGAGGGTGCAGGAGGATGG + Intronic
1158189768 18:54813568-54813590 CAGAAGGCAGAGCAGGAGCCAGG - Intronic
1158243644 18:55406095-55406117 CAGCACAGCCAGCAGGAGGCTGG + Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159949459 18:74471477-74471499 GAGGAGAAGGAGCAAGAGGCAGG - Intergenic
1160319256 18:77875089-77875111 GGGCAGACGGAGGAGGAGGGTGG - Intergenic
1160411564 18:78678541-78678563 CAGCAGAAGATGGAGGAGGCAGG - Intergenic
1160481809 18:79246687-79246709 CAGCAGGGGGAGCGCGAGGCCGG - Intronic
1160591308 18:79946073-79946095 GACGAGACGGAGGAGGAGGCGGG + Intronic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162230129 19:9259597-9259619 CCGCACTCGGAGCAGCAGGCCGG + Intergenic
1162237784 19:9321872-9321894 GAGCCCACGGAGGAGGAGGCGGG - Intergenic
1162461738 19:10817696-10817718 GGGGAGGCGGAGCAGGAGGCAGG + Intronic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162987089 19:14277708-14277730 CCGCACTCGGAGCAGCAGGCTGG + Intergenic
1163768033 19:19174191-19174213 CTGTGGACGGAGCAGGGGGCAGG + Intronic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1165361076 19:35337434-35337456 CAGGAGATGGAGCAGGACTCTGG + Intronic
1165702711 19:37950702-37950724 CAGCGGAGGGAGCAGCAGACGGG - Intronic
1165781642 19:38438077-38438099 CAGGAGATGGAGCAGGATGGTGG - Intronic
1165935363 19:39385442-39385464 CAGCAGAGTGTGCAGGACGCAGG + Intronic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166304209 19:41928447-41928469 GAGGAGAAGGCGCAGGAGGCAGG - Intronic
1166436182 19:42767751-42767773 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166455925 19:42939240-42939262 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166465718 19:43028515-43028537 AAGAAGACGGAGCAGCAGGGTGG + Intronic
1166471858 19:43084719-43084741 CAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166482991 19:43188535-43188557 CAGAAGAGGGAGCAGCAGGATGG + Intronic
1166485473 19:43207667-43207689 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166492625 19:43271573-43271595 CAGAAGAGGGAGCAGCAGGGTGG + Intergenic
1166728183 19:45041576-45041598 CAGCAGACCAGGGAGGAGGCTGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167384393 19:49155546-49155568 GAGGAGGAGGAGCAGGAGGCAGG - Intergenic
1167425659 19:49428515-49428537 CGGCCGACCGATCAGGAGGCCGG - Intronic
1167470253 19:49671822-49671844 CACCAGAAGGAGCAGGACGGAGG - Intronic
1168301449 19:55407418-55407440 CCGCAGGCGGAGCAGGAGCTCGG - Intronic
1168339399 19:55614747-55614769 CTGCACACGGAGCAGGAGAAGGG - Exonic
1168356569 19:55703908-55703930 GAGCGGACGGAGCCGCAGGCGGG + Intronic
1168450584 19:56463258-56463280 CAGAAGAGGGAGCAGGAGTGAGG + Intronic
925023303 2:588318-588340 CAGCAGAAGGTGGAGGGGGCGGG + Intergenic
925085315 2:1103027-1103049 CATCAGAGGGACCAGGGGGCGGG - Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925201379 2:1969812-1969834 CAGCAGGAGGTGCAGGAGGATGG + Intronic
925250395 2:2430895-2430917 CAGCAGAAGGAAGAGCAGGCTGG + Intergenic
925302827 2:2829107-2829129 TAGCAGAGAGAGCAGCAGGCAGG + Intergenic
925360668 2:3278244-3278266 CAGCTGATGGGGCAGGATGCAGG - Intronic
926005873 2:9373185-9373207 CTGGAGCCGGAGCAGGAGGGAGG + Intronic
926156008 2:10454397-10454419 CAGCCGAGGGAGCAGGGGCCTGG + Intergenic
926906428 2:17809969-17809991 CAGCAGACACAGCAAGAGGATGG - Intergenic
927184593 2:20473249-20473271 CAGTAGACGGAACAGGGGGGCGG - Intergenic
927385952 2:22533796-22533818 CAGCAGTCCAAGCAGGTGGCAGG - Intergenic
928456861 2:31430250-31430272 TAGCAGACGGAGGATGAGCCAGG + Intergenic
929379670 2:41335673-41335695 CCGCACTCGGAGCAGCAGGCCGG + Intergenic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929534927 2:42775670-42775692 CAGCAGAGGGTGCAGGAGAAAGG - Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929771273 2:44894206-44894228 CAGCAGACGCGGCAGGAGGGAGG - Intergenic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
932233558 2:70102711-70102733 CAGCAGGTGGGGCAGGAGGCCGG - Intergenic
932503422 2:72205132-72205154 CAACTGACAGAGCAGCAGGCAGG + Intronic
932604577 2:73156651-73156673 CAGGAGACCAGGCAGGAGGCTGG - Intronic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934188625 2:89766222-89766244 GGGCAGCCGGAGCAAGAGGCAGG + Intergenic
934658428 2:96130033-96130055 AAGCAGAGGGAGAAGAAGGCAGG + Intronic
935334170 2:101999746-101999768 CAGCATATGGAGCTGGAGGTTGG - Intronic
935445600 2:103153091-103153113 CAGCAGACAGAGCAAAAGGAGGG + Intergenic
935816723 2:106852788-106852810 CAGCAGTCGTGGCAGGAGTCAGG + Intronic
936463810 2:112729672-112729694 CAGGAGAGGAGGCAGGAGGCAGG - Exonic
936477381 2:112851180-112851202 CAGCAGACGGTGCAAGAGAAAGG - Intergenic
936568520 2:113597617-113597639 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
937258348 2:120570142-120570164 CAGCAGCCTGAGCAGGAGGTGGG - Intergenic
937268043 2:120629686-120629708 CAGGAGAGGGAGCAGGACCCAGG - Intergenic
937343200 2:121104980-121105002 CAGCAGGAGGAGCAGCAGGCCGG + Intergenic
938079558 2:128362537-128362559 CAGCAGACAGAACAGTAGACAGG - Intergenic
938285378 2:130109855-130109877 CAGCGGCCAGAGCAGGGGGCTGG + Intronic
938336023 2:130498397-130498419 CAGCGGCCAGAGCAGGGGGCTGG + Intronic
938353800 2:130622268-130622290 CAGCGGCCAGAGCAGGGGGCTGG - Intronic
938364134 2:130720591-130720613 CACTAGGAGGAGCAGGAGGCAGG + Intergenic
938430225 2:131229045-131229067 CAGCGGCCAGAGCAGGGGGCTGG - Intronic
938475044 2:131602223-131602245 CAGCGGCCAGAGCAGGGGGCTGG - Intergenic
941047097 2:160688933-160688955 CAGCACAAGGATCAGGGGGCTGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
943104622 2:183529099-183529121 CAGAAGCTGGAGCAAGAGGCAGG - Intergenic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
945040353 2:205738771-205738793 GAGGAGAGGGAGCAGCAGGCTGG + Intronic
946602889 2:221371467-221371489 CTGGCGACGGAGCAGGAGGAAGG - Intergenic
946982186 2:225229726-225229748 CCGCACTCGGAGCAGCAGGCCGG - Intergenic
947618832 2:231575867-231575889 CAGCACCCAGAGCAGGAGGGAGG + Intergenic
947826114 2:233107169-233107191 CAGCAGAGGGTGCGGTAGGCAGG + Intronic
948877462 2:240837271-240837293 CTACACACAGAGCAGGAGGCTGG + Intergenic
1169022473 20:2340239-2340261 CAGCAGGGGAAGCAGGAGGGGGG - Intronic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171506738 20:25642450-25642472 CAGCAGAAGGTGCAGGAGAAAGG + Intergenic
1171533059 20:25864696-25864718 GAGCAGAAGGAGCAAGAGGGAGG + Intronic
1171544505 20:25990034-25990056 GAGCAGACAGAGCAAGAGGGAGG - Intergenic
1172095254 20:32457255-32457277 CAGCTGAGCAAGCAGGAGGCCGG - Intronic
1172100803 20:32483285-32483307 CAGCAGCCGGAGAAGGGGGGCGG + Intronic
1172245554 20:33443244-33443266 CAGCCGAGGGCGCAGGGGGCTGG - Intronic
1172506422 20:35466187-35466209 TGGCAGATGGAGCAGGAGGTAGG + Exonic
1172547280 20:35771900-35771922 GGGCAGACGGGGCAGGGGGCGGG + Intergenic
1172606285 20:36216376-36216398 AAGCACACGGAGGAGGAGTCGGG + Intronic
1172953943 20:38742082-38742104 AAGTAGATGGAGCAGGGGGCAGG - Intergenic
1173000001 20:39098827-39098849 GAGCAGAGGGAGGTGGAGGCAGG - Intergenic
1173027277 20:39320184-39320206 CATCAGCCGGAGGAGAAGGCAGG - Intergenic
1173156505 20:40616916-40616938 CAGCTGAAGGAGCAGAAGGAAGG - Intergenic
1173750090 20:45469813-45469835 CAGCAGGCTGAGGAGGAGGGCGG - Exonic
1173791940 20:45833768-45833790 GAGCGGGCGGGGCAGGAGGCGGG + Intergenic
1173792077 20:45834214-45834236 CCGCAGCCGGTGCAGGAGCCGGG - Exonic
1174885286 20:54327571-54327593 CACCAGAAGCTGCAGGAGGCAGG - Intergenic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1176654103 21:9574553-9574575 GAGCAGAGGGAGCGGGTGGCTGG - Intergenic
1177045165 21:16160135-16160157 CAGCAGACAGAGCACCAGCCAGG + Intergenic
1177142221 21:17369514-17369536 CAGGAGTTGGAGCAAGAGGCGGG - Intergenic
1177830824 21:26137044-26137066 CAGGAGGCGGAGGTGGAGGCGGG - Intronic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179287613 21:39991504-39991526 CAGCAGACAGAGCAGTAGGGTGG + Intergenic
1179813041 21:43884525-43884547 CCTCTGAAGGAGCAGGAGGCTGG - Intronic
1180036573 21:45253375-45253397 CAGCTGTCAGAGCAGGAGCCTGG - Intergenic
1180629752 22:17220232-17220254 CAGTAGAGGGGGCAGGAGGTAGG + Intronic
1180844640 22:18974520-18974542 CTGCAGGCAGTGCAGGAGGCCGG - Intergenic
1180949765 22:19715711-19715733 CAGCAGGCAGGGCAGGAGGGCGG + Intronic
1180969347 22:19806990-19807012 GTGCAGGCTGAGCAGGAGGCTGG + Intronic
1181056830 22:20264191-20264213 CTGCAGGCAGTGCAGGAGGCCGG + Intronic
1181308147 22:21928516-21928538 CAGCTGAAGGAGCAGCAGGTGGG + Intronic
1181362923 22:22352762-22352784 CTGCAGACTAAGCAGGAGGAAGG - Intergenic
1181365730 22:22375835-22375857 CTGCAGACTGAGCAGGAGGAAGG - Intergenic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1181466793 22:23114739-23114761 CAGCTGGCAGAGCAGGAGGTTGG + Intronic
1181821950 22:25483332-25483354 CAGGAGAGGGAGCAGCAGGCTGG - Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183065698 22:35361269-35361291 CATCAGACGGAGCTGGGTGCTGG - Intergenic
1183492592 22:38124592-38124614 AAGCAGGTGGAGCAGCAGGCGGG - Intronic
1183531460 22:38356179-38356201 CAGCTGAGGGACCAGGAAGCGGG + Intronic
1184097304 22:42323452-42323474 CAGCTGAGGGAACAGGAGGACGG + Intronic
1184160356 22:42693916-42693938 GAGCAGCCGCAGCAGGAGGTCGG + Exonic
1184362416 22:44026327-44026349 CAGGAGGAGGAGCAGGACGCCGG + Intronic
1184362496 22:44026720-44026742 AAGCCGACGGTGCAGCAGGCAGG - Intronic
1184692070 22:46121966-46121988 CAGCAGAGGGAACAGCAGCCAGG + Intergenic
1184696543 22:46142654-46142676 CGGCAGAAGGAGCAGGAGCGGGG - Intergenic
1184815701 22:46867901-46867923 CAGCTGAGGGACCAGGAAGCGGG - Intronic
1185045243 22:48525394-48525416 CAGCAGGCGGAGCAGGCAGCGGG - Intronic
1185045251 22:48525443-48525465 CAGAAGGCGGAGCAGGTGGCAGG - Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
950406816 3:12810088-12810110 CAGCAGACAGTGCAGGAGGCTGG - Exonic
950522701 3:13506024-13506046 CAGCAGAGGGAGCATTAGGGAGG - Exonic
950854504 3:16092414-16092436 CGGCAGGTGGAGCTGGAGGCAGG - Intergenic
951514953 3:23548630-23548652 CAGCAGAAAAATCAGGAGGCTGG - Intronic
952761376 3:36917437-36917459 CAGCAGGGGAAGGAGGAGGCAGG + Intronic
952886004 3:38011264-38011286 CAGCAGCGGGAGGAGGCGGCAGG - Exonic
952920962 3:38283532-38283554 CATCAGAAGTAGCAGGAGCCGGG + Intronic
953292191 3:41676826-41676848 CAGCATACTGGGCAGGAAGCAGG - Intronic
953782149 3:45880703-45880725 CAGCAGAGGGAACAGTTGGCAGG - Intronic
954035597 3:47849386-47849408 CTGCAGACAGGGAAGGAGGCTGG - Intronic
955077269 3:55625453-55625475 AAGAAGAGGGAGGAGGAGGCTGG + Intronic
955235267 3:57133747-57133769 CAGCAGATGGAACAGCAGGTAGG + Intronic
956068835 3:65426047-65426069 CAGCAGAGGGAGAAGGAGTAAGG + Intronic
956527340 3:70179456-70179478 CAGCTGAGGGAGCAGGGCGCTGG - Intergenic
956678045 3:71753745-71753767 GAGGAGACGGAGGAGGATGCGGG + Intronic
958779382 3:98522852-98522874 AAGCTGGCGGAGCAGGAGGATGG - Intronic
959193784 3:103150660-103150682 CAGCTGAAGGACCAGGATGCAGG + Intergenic
961004214 3:123393785-123393807 CAGCAGCCGGGGCGGGAGGGAGG - Intronic
961432763 3:126894683-126894705 CAGCAGACGGAGCAGGAGGCTGG + Intronic
961441288 3:126954801-126954823 CAGAAGACACAGCAAGAGGCTGG + Intronic
962714413 3:138114754-138114776 CAGGACAGGGATCAGGAGGCAGG - Intronic
963681353 3:148381822-148381844 CAGCAAAGATAGCAGGAGGCAGG + Intergenic
964620706 3:158717715-158717737 ATGTAGACAGAGCAGGAGGCTGG + Intronic
964636713 3:158865889-158865911 CAACAGTCAGAGGAGGAGGCTGG - Intergenic
966762305 3:183428758-183428780 CAGGACCCGGAGCGGGAGGCTGG + Intronic
967829805 3:193909297-193909319 CAGGAGCTGGGGCAGGAGGCAGG + Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968486474 4:865452-865474 CAGCAGGCGGAGCAGCTCGCAGG + Intronic
968568511 4:1327396-1327418 CAGCTGCAGGAGCAGGGGGCGGG + Intronic
968568816 4:1328771-1328793 CAGGAGCCGGAGCAGGACCCCGG - Intronic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969121395 4:4913941-4913963 GTGCAGACTGAGCAGGAGGAGGG + Intergenic
969153677 4:5191687-5191709 CAGCCGACGAAGCAGGCTGCGGG - Intronic
969386883 4:6857365-6857387 CTGCAGATGGAGCATGAGGCTGG - Intronic
969457455 4:7308293-7308315 CAGCAGAAGGGGCAGGGGGTTGG - Intronic
969574743 4:8030315-8030337 CAGCAGGCAGAGTGGGAGGCAGG + Intronic
969845810 4:9919271-9919293 CAGCAGATTGAGCAGGCGCCTGG - Intronic
970839695 4:20452839-20452861 CTGCTGACAGAGCAGGTGGCAGG + Intronic
972840247 4:42922254-42922276 CCACAGACAGACCAGGAGGCAGG - Intronic
975665183 4:76728055-76728077 CAGCATCCTGAGTAGGAGGCTGG - Intronic
976512757 4:85930157-85930179 GGGGAGACGGAGCAGGAGGAGGG + Intronic
977313750 4:95418907-95418929 CTGAAGTCGGGGCAGGAGGCAGG - Intronic
978490066 4:109302788-109302810 CAGCAGCGGGAGCGGCAGGCCGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983752829 4:171298358-171298380 CCGCACTCGGAGCAGCAGGCCGG + Intergenic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985652172 5:1112300-1112322 CAGCAGGAGGGGCAGGGGGCTGG - Intergenic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
985959330 5:3287808-3287830 CAGCTCCTGGAGCAGGAGGCTGG + Intergenic
986454162 5:7899042-7899064 CAAGAGAGGGAGCAAGAGGCAGG + Intronic
986591216 5:9372916-9372938 CCGCAGGAGGAGCAGGTGGCAGG + Intronic
986790663 5:11156430-11156452 CAGCAGAAGGAGCATGTGGTAGG - Intronic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987146213 5:14993889-14993911 CAGCACACGGAGCGGGTGGGAGG + Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988669205 5:33362796-33362818 CTGCAGTCTGAGAAGGAGGCAGG + Intergenic
990527288 5:56640473-56640495 CAGCAGAAGAGGCAAGAGGCTGG + Intergenic
991485837 5:67135819-67135841 CAGCAGAGGAAGCTAGAGGCAGG + Intronic
992551757 5:77866253-77866275 CAGGAGACGGAGCAGGAGTGGGG + Intronic
992948939 5:81837852-81837874 TTGCAGACTGAGCAGGATGCTGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996205866 5:120734284-120734306 GGGAAGAGGGAGCAGGAGGCTGG + Intergenic
997402555 5:133613361-133613383 ACGCAGCCAGAGCAGGAGGCAGG - Intergenic
998453029 5:142249496-142249518 CAGCAGACTGGGAAGGCGGCTGG + Intergenic
998477199 5:142431998-142432020 CAGCATGGTGAGCAGGAGGCGGG + Intergenic
999173904 5:149618271-149618293 CAGCTGCTGAAGCAGGAGGCGGG + Exonic
999322245 5:150622737-150622759 GGGCAGATGGAGCAGGAGCCTGG + Intronic
999850241 5:155529700-155529722 CATCAGAAGGAGGAGGATGCTGG + Intergenic
1000009845 5:157220584-157220606 CAGCAGAGTGGTCAGGAGGCAGG + Intronic
1001842219 5:174887652-174887674 AAGCAGAGGCAGCAGGAGCCAGG - Intergenic
1002060333 5:176621855-176621877 CAGCAGACGCAGCGGGTGGGGGG - Intronic
1002085881 5:176775037-176775059 CAGCAAACTGAGGAGGAGGGAGG - Intergenic
1002103144 5:176867242-176867264 CTACAGACGGGGCAGGAGGAGGG + Intronic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002601637 5:180357061-180357083 CAGCAGAGGGCCCAGGGGGCTGG + Intergenic
1002761507 6:205988-206010 CAGGTGACTCAGCAGGAGGCTGG - Intergenic
1003543921 6:7042472-7042494 CAGCAGCCCGACCAGGAAGCCGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004194158 6:13488519-13488541 CAGGAGCCGAAGCAAGAGGCGGG - Intergenic
1004233721 6:13854992-13855014 CAGCACTCGGAGCAGCCGGCCGG - Intergenic
1004632713 6:17437186-17437208 CCACAGACAGAGCAGGAGGATGG - Intronic
1005083640 6:21981642-21981664 CAGCACAGGAAGGAGGAGGCAGG - Intergenic
1005442231 6:25882311-25882333 GAGCAGACGGCGCTGGAGCCCGG + Intergenic
1005871398 6:29976525-29976547 GAGCAGAAGGAGCTGGAGGTAGG - Intergenic
1005883016 6:30074714-30074736 GAGGAGCGGGAGCAGGAGGCTGG - Intronic
1006106704 6:31721251-31721273 CAGCAGATAGAGGAGAAGGCAGG + Intronic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006518831 6:34559859-34559881 CAGCCCAGGGAGCTGGAGGCAGG - Intergenic
1006682198 6:35805326-35805348 CCGCGGACGGAGGAGGGGGCGGG + Exonic
1006981952 6:38154271-38154293 CAGCAGGCAGAGGAGGGGGCGGG - Exonic
1007109377 6:39304185-39304207 GAGCCGAGGGAGCTGGAGGCAGG + Intronic
1007406477 6:41638699-41638721 CAGCGGGCGGCGCCGGAGGCGGG - Intronic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010373705 6:75141425-75141447 CAGCAGACGGAGCAGGAAGCAGG + Intronic
1012286850 6:97401007-97401029 GAGCAGACTGAGGAGGAGGAAGG + Intergenic
1012437918 6:99234776-99234798 CAGCTGAAGGAGCAGGAGAAGGG - Intergenic
1012534880 6:100283511-100283533 CAGCAGAGGCTGCTGGAGGCTGG - Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1014645528 6:123968054-123968076 CAGCAGGTGGAGCAGGCAGCTGG + Intronic
1015054491 6:128883259-128883281 CAGCAGAAGGAGGAGGACCCCGG - Exonic
1016482333 6:144495425-144495447 CCGCACTCGGAGCAGCAGGCTGG - Intronic
1018578901 6:165290433-165290455 CATCAGACACAGCAGGAGGAAGG + Intronic
1018623042 6:165750376-165750398 CAGCTCAGGGAGCAGGAGTCTGG + Intronic
1018915904 6:168132201-168132223 CAGCTGGCTGAGAAGGAGGCAGG - Intergenic
1018983434 6:168617459-168617481 CTGAAGACGGGGCAGGAAGCTGG + Intronic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019354804 7:572887-572909 GAGCAGACAGGGCAGGACGCCGG + Intronic
1019402986 7:866811-866833 CAGCAGAAGGTCCAGGAGACGGG - Intronic
1019917010 7:4140106-4140128 CAGCAGCCAGAGCACGAGGAAGG - Intronic
1019944286 7:4314214-4314236 CGGCAGTCGGAGCAGCCGGCCGG - Intergenic
1019959823 7:4449798-4449820 CAGCAGCAGGAGCAGGGGGAAGG - Intergenic
1019965769 7:4497206-4497228 CTGCACTCGGAGCAGCAGGCCGG - Intergenic
1022589088 7:31643774-31643796 CAGCAGATGCAGCAGTGGGCAGG - Exonic
1023002462 7:35824401-35824423 CAGCATACAGAGTAGGAAGCAGG - Intronic
1023337653 7:39186935-39186957 CAGAACACAGAGCAGGCGGCAGG - Intronic
1023897323 7:44444834-44444856 CAGCAGCCTGAACAGAAGGCTGG - Intronic
1024033077 7:45481504-45481526 AAGCAGAGGGAGCAGGGGGTGGG - Intergenic
1024299531 7:47876569-47876591 CAGCAGGAGGAGCAGGAGGGAGG + Intronic
1024691261 7:51805919-51805941 CCGCACTCGGAGCAGCAGGCCGG + Intergenic
1024972711 7:55085384-55085406 CAGCATGGGGAGCAGGATGCTGG + Intronic
1025201905 7:56967383-56967405 GAGCAGAGGGGGCGGGAGGCAGG - Intergenic
1025284352 7:57650147-57650169 GAGCAGAAGAAGCAGGAGGGAGG + Intergenic
1025635037 7:63314464-63314486 AAGCAGGCGGAGCACGAGGTCGG - Intergenic
1025647658 7:63433706-63433728 AAGCAGGCGGAGCACGAGGTCGG + Intergenic
1025670041 7:63609545-63609567 GAGCAGAGGGGGCGGGAGGCAGG + Intergenic
1026178306 7:68016907-68016929 CAGCACACAGCCCAGGAGGCCGG - Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026822177 7:73557258-73557280 CAGCAGCCGCAGCAGGTGGGCGG + Intronic
1028567167 7:92246094-92246116 CCGGAGCCGGAGCCGGAGGCGGG + Exonic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1030820371 7:114085796-114085818 GAGAAGGCGGAGCAGGAGGTGGG + Intergenic
1032017395 7:128388808-128388830 GAGCAGGTGGAGCAGGAGGCTGG + Intergenic
1032312759 7:130803575-130803597 CAGCAGGAGGAGGAGGATGCTGG + Intergenic
1032836874 7:135682851-135682873 CAGCAGAGGAAGCGGGAGACAGG + Intronic
1033255613 7:139798985-139799007 CGGCAGGTGGAGAAGGAGGCTGG - Intronic
1033606085 7:142929329-142929351 CAACAGATGGAGCTGAAGGCAGG + Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034469083 7:151246188-151246210 CAGAAGTCGGAGCAGGGAGCCGG - Intronic
1034532129 7:151702413-151702435 CAGCAGACGGATGGGGATGCAGG + Intronic
1034964914 7:155384881-155384903 CCGTAGACAGAGCAGGAGCCAGG - Intronic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1037226788 8:16602245-16602267 CAGCAGACGGATCGGGAGCCAGG - Intergenic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038612189 8:29067921-29067943 CAGCAGAGGGGACAGGGGGCAGG - Exonic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039445770 8:37630654-37630676 TTGCAGAGGGAGCAGCAGGCAGG - Intergenic
1039579351 8:38651157-38651179 CAGGAGGCGGAGCAGGCGTCGGG + Intergenic
1040708812 8:50162793-50162815 CAGCAGTGGGAGCAGATGGCAGG - Intronic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041709560 8:60881498-60881520 CAGAAGTCGGAGGAGAAGGCAGG - Intergenic
1042107924 8:65348588-65348610 GGGCAGCAGGAGCAGGAGGCAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042785041 8:72537195-72537217 GAGGAGGCGGAGCGGGAGGCTGG + Intergenic
1045674058 8:104588923-104588945 GAGGAGACGGAGGAGGAGGGAGG + Exonic
1045815394 8:106271232-106271254 TAGTAGACGGAGGAGGAGCCAGG - Intronic
1048006365 8:130422449-130422471 CAGCCCAGGGAGCAGGAGCCAGG - Intronic
1048866223 8:138763727-138763749 CAGCGGAGGGAATAGGAGGCAGG - Intronic
1048870237 8:138791226-138791248 CAGCAGGCAAAGCAGGATGCTGG + Intronic
1049236135 8:141513311-141513333 CAGCGGAGGGAGCTGGAGCCTGG + Intergenic
1049243510 8:141550367-141550389 CAGCAGAGGGAGCAGGGGCCAGG + Intergenic
1049344040 8:142128998-142129020 CCGCAGAGGGAGCAGGAGAGCGG + Intergenic
1049536559 8:143185360-143185382 CAGCAGACGCAGGAGGCGGGAGG - Intergenic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050192348 9:3040537-3040559 CAGTAGCAAGAGCAGGAGGCTGG - Intergenic
1051092371 9:13424793-13424815 CAGCAGACGGAGCAAGAATCAGG + Intergenic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1053158975 9:35800481-35800503 CAGGTGATGGAGGAGGAGGCAGG + Exonic
1054999065 9:71427751-71427773 TAGTAGAGGGAGGAGGAGGCAGG + Intronic
1056579548 9:87880836-87880858 CAGCAGCAGGAGCAAGGGGCTGG + Intergenic
1057353800 9:94319629-94319651 CAGGAGCTGGAGCAGGAGGAAGG - Exonic
1057619146 9:96619540-96619562 CAGGAGCCGGAGGAGGAGCCCGG + Exonic
1057653951 9:96937963-96937985 CAGGAGCTGGAGCAGGAGGAAGG + Exonic
1057895715 9:98906993-98907015 CAGCTGTCGGGGCAGGAGGCTGG + Intergenic
1058293139 9:103269727-103269749 CAGCAGAAGAAGCATGATGCTGG + Intergenic
1058472960 9:105299825-105299847 CAGCAGACACAGCAGGCAGCAGG - Intronic
1060188467 9:121577849-121577871 CAGCAGAGGGAGCAGGCACCAGG + Intronic
1060255976 9:122031415-122031437 CTGGAGCCGGAGCAGGTGGCTGG - Intronic
1060297736 9:122354787-122354809 CAGCAGGGCCAGCAGGAGGCTGG + Intergenic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1060909795 9:127340509-127340531 CAGCATACCTGGCAGGAGGCTGG - Intronic
1060986859 9:127825071-127825093 CAGAAGACGCAGCAGGAGTGGGG - Intronic
1061359558 9:130132330-130132352 GGGCAGCCTGAGCAGGAGGCAGG + Intronic
1061426328 9:130500627-130500649 AAACAGAGGGCGCAGGAGGCAGG - Intronic
1061667801 9:132170457-132170479 CTGCAGGCCGAGAAGGAGGCAGG + Intronic
1061920895 9:133781770-133781792 CAGCAGAGGGATGAGGAGGGGGG + Intronic
1061934055 9:133847478-133847500 CAGCAGATGACGCATGAGGCTGG + Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062212186 9:135371153-135371175 CAGCAGGGGGAGCTGGAGGCAGG - Intergenic
1062294848 9:135818965-135818987 AAGCAGACTGAGCAGGAGCCTGG - Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062468230 9:136690900-136690922 CAGCACACCCACCAGGAGGCCGG - Intergenic
1203631825 Un_KI270750v1:78011-78033 GAGCAGAGGGAGCGGGTGGCTGG - Intergenic
1187139028 X:16575536-16575558 CGGCAGTCGGAGCAGCTGGCCGG + Intergenic
1187447630 X:19373014-19373036 GAGCAGAAGGAGGGGGAGGCGGG + Intronic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190335727 X:49260634-49260656 CAACAGACAGTGCAGGAAGCCGG - Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1192125608 X:68498589-68498611 CGGCGGAGGGAGCAGGAGGTTGG + Exonic
1192201448 X:69069028-69069050 GGGCAGAGGGTGCAGGAGGCAGG - Intergenic
1192340964 X:70263050-70263072 AAGCAGTAGGAGCAGGAAGCTGG - Intergenic
1194890497 X:99372313-99372335 CAGCACTCGGAGCAGCAGGCCGG - Intergenic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1196786092 X:119422688-119422710 CAGCAGGTTGAGCAGGAGGCAGG - Intronic
1197798447 X:130322897-130322919 CAGCAAACGGAGAAGATGGCAGG - Intergenic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1200401800 X:156024251-156024273 AAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic