ID: 961434274

View in Genome Browser
Species Human (GRCh38)
Location 3:126905881-126905903
Sequence CTTCAAGAACTGCAGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961434269_961434274 12 Left 961434269 3:126905846-126905868 CCCTCCAGAAGCTGGATAGCTAG 0: 1
1: 0
2: 1
3: 12
4: 138
Right 961434274 3:126905881-126905903 CTTCAAGAACTGCAGGAATCAGG 0: 1
1: 0
2: 2
3: 26
4: 202
961434270_961434274 11 Left 961434270 3:126905847-126905869 CCTCCAGAAGCTGGATAGCTAGT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 961434274 3:126905881-126905903 CTTCAAGAACTGCAGGAATCAGG 0: 1
1: 0
2: 2
3: 26
4: 202
961434272_961434274 8 Left 961434272 3:126905850-126905872 CCAGAAGCTGGATAGCTAGTGGT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 961434274 3:126905881-126905903 CTTCAAGAACTGCAGGAATCAGG 0: 1
1: 0
2: 2
3: 26
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961434274 Original CRISPR CTTCAAGAACTGCAGGAATC AGG Intronic
900848307 1:5121332-5121354 CATCAAGACCTGCAGGGACCTGG + Intergenic
901630920 1:10647803-10647825 CTCCTGGAACTGGAGGAATCCGG + Exonic
902194822 1:14790688-14790710 CTCCTAGAATTGGAGGAATCCGG + Intronic
902242144 1:15096251-15096273 TTTCAAAAACTTCAGGAGTCTGG + Intronic
902305648 1:15536793-15536815 ATTCAAGAACTGGAAGAATTGGG + Exonic
902375867 1:16029717-16029739 CATCCAGAACTGCAGGAAGGGGG - Exonic
904531791 1:31174821-31174843 CAGCATGAACTGCAGGAGTCAGG - Intergenic
905900411 1:41577893-41577915 CTTCCAGAATTGCACCAATCTGG - Intronic
906151474 1:43590262-43590284 GTGCAAGGACAGCAGGAATCAGG - Intronic
913426477 1:118737000-118737022 CTTCATGAACTCCAGGCAGCCGG - Intergenic
913557102 1:119978481-119978503 CTTCAAGAACTGCAGAGTCCAGG + Intronic
914884745 1:151575634-151575656 CTTCTAGAACTTCAGGAATTTGG + Intronic
916311623 1:163404919-163404941 CTTCTAGAACTGCAGGCTTTGGG + Intergenic
917295388 1:173513607-173513629 CTTCAAAAAATGAATGAATCCGG - Intronic
920130352 1:203727414-203727436 CTTCAGGAACTTCAGGGATCGGG - Exonic
920521275 1:206628885-206628907 CTGCAGGAACTGCAGAGATCAGG - Intergenic
922462941 1:225826979-225827001 CCTACAGAACTGCAGGAATAAGG + Intronic
922698907 1:227746556-227746578 CTGCATGAGCTGCAGGAACCAGG + Intronic
923282522 1:232458043-232458065 CTTCATGACCTGCAGAAATGTGG + Intronic
924266677 1:242289649-242289671 CATCAAGAATTGCAGGAGGCTGG - Intronic
1063112290 10:3047606-3047628 CTAGAAGAGCTGCAGGAATAAGG + Intergenic
1064207758 10:13338547-13338569 CTTCAGCAACTGCAGGAGTCTGG + Intronic
1066718156 10:38308908-38308930 CATCAAGAATTGCAGGAGGCTGG + Intergenic
1067442540 10:46317591-46317613 CTTCAAGAACAGCTGCAAGCTGG - Intronic
1068472792 10:57486471-57486493 ATTCAAGAACAGCAGCAACCAGG + Intergenic
1071134998 10:82443552-82443574 CTTCAAGAACTCTAGTAATTTGG + Intronic
1072249829 10:93572700-93572722 ATTCAGGGAGTGCAGGAATCAGG + Intronic
1072882115 10:99237679-99237701 GTTCAGGAACTGAAGGAAACAGG - Intergenic
1074757076 10:116632039-116632061 CTTGAAGAACTGCAGGACATAGG + Intronic
1074948322 10:118303026-118303048 CTTCAAGAACCACTGGAATGGGG + Exonic
1075544881 10:123347559-123347581 CTTCTAGTGCTGCAGGTATCTGG + Intergenic
1078831725 11:14983708-14983730 CTTTAAGACCTGCAGGAACCTGG - Intronic
1080733225 11:34982458-34982480 CTTCAAAAAATCCATGAATCCGG + Intronic
1080877993 11:36294310-36294332 CTTAAAGGACTGCAGGACCCTGG - Intergenic
1084409484 11:68998150-68998172 CTTCAAGAACAGCTGGATCCAGG - Intergenic
1085717181 11:78882702-78882724 CCTCAAGAACTGCATGACCCAGG + Intronic
1087354016 11:97071616-97071638 CTTCAAAAACTCAAAGAATCTGG - Intergenic
1087876028 11:103358746-103358768 TTTTAAGAACTGCATGAATTGGG - Intronic
1095230065 12:39729113-39729135 CTTCAAAAACTCAAGGAATCTGG - Intronic
1097853104 12:64433452-64433474 CTTCAAAAATTGCATGAAGCAGG - Exonic
1098593584 12:72243380-72243402 ATTCAAGAACTGCATGCAACTGG - Intronic
1099142454 12:78995776-78995798 CAGCAACAACTGCAGGAATTGGG - Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099300550 12:80889324-80889346 CTGGAAAAACTACAGGAATCTGG - Exonic
1100492195 12:95091706-95091728 TTCCAAGAACTGCAGAAATTAGG - Exonic
1100513713 12:95304888-95304910 GTTCAAGCTCTGCAGGAAACTGG - Intergenic
1101396136 12:104349738-104349760 CTTCAAGAACTGCTGGCAGGAGG - Exonic
1101532697 12:105588507-105588529 CACCCAGAACTTCAGGAATCTGG + Intergenic
1104391945 12:128398192-128398214 CTTCAGGCACTGCTGGATTCAGG + Intronic
1106050003 13:26180926-26180948 CTACAGGAAGTGCAGGAAGCAGG - Intronic
1106375372 13:29181473-29181495 CTTCAAAAAGTGCTGGCATCAGG - Intronic
1106705993 13:32279995-32280017 CTTCAAGAAGGGCAGCAATGTGG - Intronic
1107478139 13:40760889-40760911 CTCCAAGAACTTCAGGAATTTGG - Intronic
1107644185 13:42477139-42477161 CATCAAGATATGCAAGAATCAGG - Intergenic
1108665536 13:52626165-52626187 CTCCAAGAACTTTAGGAATTTGG + Intergenic
1109746762 13:66633885-66633907 CTGCAAGAACTGCAGGATTAAGG - Intronic
1111687039 13:91515442-91515464 CTTGAATAACTGCATGAATTAGG + Intronic
1112483664 13:99800500-99800522 CTTCAGGGACTGCTGAAATCAGG - Intronic
1112522273 13:100107005-100107027 TTACAAGGACAGCAGGAATCCGG - Intronic
1114711885 14:24787003-24787025 CTTGAAGAACTGCAGGATGCAGG + Intergenic
1114751919 14:25214242-25214264 CCTTAAGCACTGCAGGAATCTGG - Intergenic
1117470794 14:56042670-56042692 CTTCAGGAAATGAAGGAAGCAGG + Intergenic
1122119688 14:99545524-99545546 CTTCAAGGGCTGCACGCATCTGG + Intronic
1123679204 15:22745562-22745584 ATTCCAGAACTGCAGGAATATGG + Intergenic
1123964375 15:25439669-25439691 CGTCAACAACTGCAGGAGACGGG - Intergenic
1124331424 15:28820012-28820034 ATTCCAGAACTGCAGGAATATGG + Intergenic
1124868782 15:33520083-33520105 GTTGAAGAACTGCAGGAAAGGGG + Intronic
1126355974 15:47796323-47796345 GTTCAATTACTGCAGGATTCGGG + Intergenic
1127642829 15:60931480-60931502 CTTGAAAGACTGCAGGAGTCTGG - Intronic
1127954439 15:63840931-63840953 CTTCAGGAACTTCTGGAGTCAGG + Intergenic
1130131748 15:81149389-81149411 CATCAAGTACTGCAGGATTTAGG + Intergenic
1133926408 16:10196524-10196546 CTCCAAGAACAGCTGGAGTCTGG + Intergenic
1135208038 16:20499362-20499384 CTTCCCGAAGTGCAGGAACCTGG - Intergenic
1135210861 16:20524338-20524360 CTTCCCGAAGTGCAGGAACCTGG + Intergenic
1136086040 16:27885775-27885797 CTTCAGGAACAGCTGGAACCAGG - Intronic
1136466319 16:30446336-30446358 CTTCAAGAACTCTAGGACTCAGG + Intergenic
1137466586 16:48715322-48715344 CTTCAAGAACAGTAGGAAACAGG + Intergenic
1138075642 16:54039743-54039765 CTTCAAGAACTTCAGGGATCAGG + Intronic
1138614117 16:58150886-58150908 CTTAAAGAACTGAGGGAAGCTGG - Intergenic
1140312110 16:73859521-73859543 CTTCTAGAAGTGAAGGAAACTGG - Intergenic
1141439409 16:84019985-84020007 CTGCGAGAACTTCAGGCATCAGG - Intronic
1142898802 17:2999559-2999581 CCTCATGAACCCCAGGAATCAGG - Intronic
1144683480 17:17210871-17210893 CTTCAAGAACTGCATGCCTGTGG + Intronic
1148109401 17:45136305-45136327 CTGCAAAAACTGCAGTGATCAGG - Intronic
1150479236 17:65496859-65496881 CTTCCAGAAAGGCAGGAATGAGG + Intergenic
1151313198 17:73306889-73306911 CTGCCAGAACTGCAGGTGTCTGG + Intronic
1152511942 17:80795935-80795957 CTTACAGAACTACAGGAATGTGG - Intronic
1153005663 18:497053-497075 CTTCAAGTACTGCAGCAACGGGG + Intronic
1153484747 18:5585728-5585750 CTTCATGAACTGCATCACTCAGG + Intronic
1157753288 18:50196396-50196418 CTTTAAGAGCTACAGGAATCCGG - Intergenic
1158457490 18:57621367-57621389 TTTGAAGAACTGCAGGAGTAGGG + Intronic
1162027059 19:7900397-7900419 CTTCCAGCACTGCCGGAAGCTGG + Exonic
1162730458 19:12715425-12715447 CTTGAAGAACTGCAGGAACTTGG + Exonic
1164141072 19:22464018-22464040 GTTAGAGAACTACAGGAATCTGG + Intronic
1165366718 19:35371862-35371884 CTTCCAGAACTCCAGGTAGCAGG - Exonic
1167391373 19:49197069-49197091 CTTCAGGGACGGCAGGATTCAGG + Intronic
926368909 2:12161047-12161069 TTTTAAGAACAGCAGGAATCTGG - Intergenic
927081114 2:19631473-19631495 CTTCAGGAACAGCTGGAACCAGG - Intergenic
928336338 2:30401658-30401680 CTTCAGGAACTGTTGGACTCAGG - Intergenic
929919052 2:46159592-46159614 CGTCATGAACTGCAGGGATGAGG - Exonic
934115224 2:88783521-88783543 CTCCAAGAACTACTGGAAGCAGG + Intergenic
934628358 2:95885433-95885455 CTCCAAGAACTACTGGAAGCAGG - Intronic
934628606 2:95889186-95889208 CTTCAGGAACTACTGGAAGCAGG - Intronic
934631429 2:95928457-95928479 CTCCAAGAACTACTGGAAGCAGG - Intronic
934802605 2:97180526-97180548 CTCCAAGAACTACTGGAAGCAGG + Intronic
934804519 2:97206722-97206744 CTTCAGGAACTGCTGGAAGAAGG + Intronic
934805166 2:97216090-97216112 CTCCAAGAACTACTGGAAGCAGG + Intronic
934832317 2:97541296-97541318 CTCCAAGAACTACTGGAAGCAGG - Intronic
935679187 2:105621320-105621342 CTTCAAGAAATGGAGGGACCAGG - Intergenic
938192505 2:129296554-129296576 CTGCTAGAACTGCAGGAGCCAGG + Intergenic
939964738 2:148599170-148599192 CATTAAAAACTGCAGGAAGCAGG - Intergenic
940641479 2:156348997-156349019 CTTATAGACCTGAAGGAATCTGG + Intergenic
942224368 2:173802386-173802408 CTTGCAGAACTGAAGGAAACAGG + Intergenic
943114019 2:183643894-183643916 CTTCAAGTTCTGCAGGCATAAGG - Intergenic
943537120 2:189166524-189166546 CTTCAGAAACAGTAGGAATCTGG + Intronic
943857043 2:192809128-192809150 ATTTAAGAACTTCATGAATCTGG - Intergenic
944389694 2:199204741-199204763 CCTTAAGAAGTGCAGGAATTTGG - Intergenic
946410268 2:219512038-219512060 CTCCCAGATCTCCAGGAATCTGG - Intergenic
947643383 2:231720396-231720418 CTTCAGGTACAGCAGGATTCAGG + Intergenic
948167031 2:235870843-235870865 CTTTAAGTACAGCAGGAAGCAGG - Intronic
1169434434 20:5573173-5573195 ATTCAAGAATTGCTTGAATCTGG - Intronic
1170314762 20:15030811-15030833 GATCATGAACTGCAGGACTCAGG - Intronic
1171334318 20:24370060-24370082 CCTCGAGAACTGCAAAAATCAGG + Intergenic
1172175340 20:32968959-32968981 CTCCAAGAACTGCAGCATTGAGG - Intergenic
1172347381 20:34213542-34213564 CTTCAAAAATTGCATGAAGCAGG + Intronic
1173630731 20:44512976-44512998 CTTCACAAAATCCAGGAATCTGG + Exonic
1175159920 20:57000600-57000622 CTCCAAGATCTGCAGCAATCAGG - Intergenic
1177659656 21:24066276-24066298 CTTCAAGACTTGCAGGAGTCAGG - Intergenic
1178314217 21:31555885-31555907 ACACTAGAACTGCAGGAATCTGG + Intronic
1179661692 21:42879876-42879898 CTTCAAGAAGTGAATGAACCGGG + Intronic
1181322651 22:22020259-22020281 GTTCAAGGACTGCTGGAAACAGG - Intergenic
1181486864 22:23237064-23237086 CTTCAAGAACTCCACGATCCTGG - Intronic
1182826224 22:33267144-33267166 GTACAAGAACTGCTGGAATCCGG + Intronic
1183822618 22:40358998-40359020 CTCAAAGAGCTGCAGGAAACTGG - Exonic
1184803098 22:46774446-46774468 CTTCATGAACCGCAGCACTCGGG - Intronic
949879325 3:8649266-8649288 CTTCATGAACTGCAGGAGCCAGG - Intronic
950252447 3:11477734-11477756 CAGGAAGAACTGCAGGAACCAGG + Intronic
952489727 3:33856275-33856297 ATTCCAGAACTGCAGGAATATGG + Intronic
952726908 3:36596215-36596237 CTTCAAGAACTTCATGAGGCAGG - Intergenic
952780386 3:37091459-37091481 CTTAAAGAACTAAAGGTATCAGG - Exonic
952832176 3:37574475-37574497 CTGCAAGACCTGCATGAATATGG - Intronic
952844593 3:37676756-37676778 CTTCAAGACCTAAGGGAATCTGG + Intronic
953247045 3:41202921-41202943 CTTCAAGGACAGCAGGGTTCAGG - Intronic
953742276 3:45547942-45547964 CCTGAGGAACTGCAGGACTCAGG + Exonic
955437060 3:58912587-58912609 CTTCTAGAAGTCCAGGAAGCAGG - Intronic
955797392 3:62651981-62652003 CTTCAGGAAAGGCTGGAATCAGG + Intronic
957114157 3:76003112-76003134 CTGCAGTTACTGCAGGAATCTGG - Intronic
960963385 3:123088297-123088319 CTTCGGGAACTGGAGGTATCAGG - Intronic
961434274 3:126905881-126905903 CTTCAAGAACTGCAGGAATCAGG + Intronic
961549751 3:127662242-127662264 CTGCAAGGACTGGAGCAATCTGG + Exonic
963034702 3:141015845-141015867 CTTCAAGCAATGCAGGACTCAGG + Intergenic
963921561 3:150910551-150910573 CTTCAAGACCAGCAGGAAAGAGG + Intronic
964084501 3:152799578-152799600 CTTGAGGATCTGCAGGAGTCTGG - Intergenic
965126145 3:164632640-164632662 TTTCAAGTTCTGGAGGAATCAGG - Intergenic
966080148 3:175990132-175990154 ATCCAAGAACTTCAGGAGTCTGG + Intergenic
966641363 3:182194456-182194478 CTTTAAGCACTGCAGGAAGGTGG + Intergenic
966949608 3:184804263-184804285 CCTAAAGAACTGCAGAATTCTGG - Intergenic
967716268 3:192765516-192765538 CTTCAGGAACAGCTGGAATCAGG + Intronic
968208403 3:196825250-196825272 CTGCAAGAATTGCTGGAACCCGG + Intronic
969921417 4:10543898-10543920 CTTCAACAACAGCAGCAATCTGG + Intronic
970930832 4:21509815-21509837 CTTTAAGAACGGCAACAATCTGG + Intronic
971699775 4:29956108-29956130 CTTCAGGTACAGCAGGATTCAGG + Intergenic
971835037 4:31751794-31751816 CTTCAGGAATTGAAGGAATTGGG - Intergenic
974019050 4:56676882-56676904 TTTCAAGAACTGCCACAATCTGG + Intronic
974722119 4:65753951-65753973 GTTCAAGAACAGCAGAAATAGGG - Intergenic
976541859 4:86286726-86286748 CCTCAAGTACTTCAGGAATGAGG + Intronic
976761465 4:88553864-88553886 GTTCAAGAACTGCTTGAACCTGG + Intronic
978463401 4:108983009-108983031 CTTATAAAACAGCAGGAATCAGG + Intronic
979323971 4:119357552-119357574 CTTTATGAACTGCATAAATCTGG + Intergenic
980669590 4:135987219-135987241 TTTAAAGAGCAGCAGGAATCTGG + Intergenic
983241814 4:165242237-165242259 CTTTATGAACTGCATAAATCTGG + Intronic
983782745 4:171692529-171692551 CTTAAAGAACTAGAGAAATCTGG + Intergenic
984756606 4:183330831-183330853 CTTCATGAACAGGAGGACTCTGG + Intergenic
984916339 4:184728348-184728370 CATCTAGAACTGCAGTAGTCAGG - Intronic
985510954 5:313625-313647 CATCAAGACCTGCAGGAACATGG - Intronic
985867156 5:2523097-2523119 CTTCAACAAGTGCAGCAAACCGG + Intergenic
987780695 5:22430564-22430586 TTTCAATAACTGCAGCACTCAGG - Intronic
988181148 5:27796250-27796272 CTTCAGGAGCTTCAGGATTCAGG + Intergenic
988528922 5:32010267-32010289 CTTCAAGAACTGCTTGGTTCTGG + Intronic
989598173 5:43177335-43177357 CTTCAAGTACTGAAGCAAACTGG + Intronic
991411703 5:66352411-66352433 CTTCATGGACAGCAAGAATCTGG - Intergenic
992286387 5:75239935-75239957 TTTCAGGAATGGCAGGAATCAGG + Intergenic
994617584 5:102125199-102125221 CTTCAAAAACAGCAGGAATCAGG - Intergenic
994739376 5:103599049-103599071 CTTCAAGAACAGCAGGATCCAGG - Intergenic
995997296 5:118317320-118317342 CTTCACAAACTGGAGGAATTTGG + Intergenic
997074074 5:130651540-130651562 GTTCCAGAGCTGCAGGACTCAGG - Intergenic
998392793 5:141798167-141798189 TTTCAAGAACACCAGTAATCTGG + Intergenic
1001641739 5:173249114-173249136 CTTCCTGAACAGCAGCAATCAGG - Intergenic
1004142173 6:13028450-13028472 CTTCAATCAATCCAGGAATCAGG + Intronic
1005160958 6:22863121-22863143 CTTCAAAAACTCCATGAATGAGG + Intergenic
1005296990 6:24436407-24436429 CTGTAAGAACTGCAGGCAGCTGG + Intronic
1005297215 6:24437991-24438013 CTGCAAGAACTGCAGACAGCTGG + Intronic
1005942817 6:30573548-30573570 CTTCAGCAATTGCAGGAAGCAGG + Intronic
1008070247 6:47092235-47092257 ACTCAAGAACTGCGGTAATCAGG - Intergenic
1008865724 6:56207226-56207248 CTTCAAAAAATCCATGAATCCGG + Intronic
1010158272 6:72821061-72821083 CTTCAAGAGCTGGTGGAATGAGG + Intronic
1015983268 6:138860556-138860578 CTTCAATTACTGCATGAAACAGG - Intronic
1016847672 6:148584856-148584878 CTTCAAAAAATCAAGGAATCCGG - Intergenic
1018106051 6:160487401-160487423 CTCCAACTACTGCAGGAATCCGG - Intergenic
1018106568 6:160492931-160492953 CTCGAACTACTGCAGGAATCCGG - Intergenic
1021135683 7:16962409-16962431 CTTCATTAACTCCAGGAAACTGG - Intergenic
1021135691 7:16962507-16962529 CTTCATTAACTTCAGGAAACTGG - Intergenic
1021193245 7:17645921-17645943 TTTAAAAAACTGCAGGGATCAGG - Intergenic
1025119713 7:56290844-56290866 CTTCAAAAATTGCATGAAGCAGG - Intergenic
1027664638 7:81030000-81030022 CTACAAGAACAGCAGCAATTGGG + Intergenic
1029541525 7:101185625-101185647 CCACAGGAACTTCAGGAATCAGG + Intergenic
1031602209 7:123723762-123723784 TTTCAGGAACAGCAGGAAGCTGG - Intronic
1032083368 7:128870801-128870823 CTTTAACAAATTCAGGAATCAGG - Intronic
1033193718 7:139308559-139308581 CTCCAAGAACTGGTGGAATTTGG + Intergenic
1034044944 7:147917825-147917847 ACTCCAGAACTGCAGGAGTCTGG - Intronic
1038582853 8:28765079-28765101 CTTCAAGCTCTTCAGGGATCAGG + Intergenic
1040471199 8:47737365-47737387 CTTGAAGAACTGCCGGAGGCCGG + Exonic
1041245519 8:55885197-55885219 CCTATAGAACTGCATGAATCGGG + Intronic
1042699513 8:71596902-71596924 CTTCAGGAAGAGCAGGAACCAGG + Intergenic
1045116698 8:98990550-98990572 CTTCATGAACTGTAGAAAACTGG - Intergenic
1045441186 8:102213123-102213145 CTTCAAGAAATCCAGTAATTTGG - Intronic
1046759783 8:118009306-118009328 CTTCCAGGACTGAAGTAATCTGG - Intronic
1048645197 8:136412103-136412125 CTTGAATAACTGCAGGAGGCAGG - Intergenic
1052821954 9:33144604-33144626 CCTCAAAAACTTCAGGAAACAGG + Intronic
1053312984 9:37031112-37031134 CTTCAAGAACTCCTGAAAACAGG - Intronic
1055058106 9:72042114-72042136 CTTCAGGAAGGGCAGGACTCAGG - Intergenic
1059008628 9:110432378-110432400 CCTCAAGAACCTCAGGAATTTGG + Intronic
1059701759 9:116781796-116781818 GGGCAAGAACTGCAGGTATCTGG - Intronic
1187732369 X:22268709-22268731 CTTGCAGAACTGAAGGCATCTGG + Intergenic
1188542498 X:31266255-31266277 CCCCAAGACCTGCAGAAATCAGG - Intronic
1189092954 X:38106715-38106737 TGTCAAGAATTGCAGAAATCTGG + Exonic
1192367934 X:70490363-70490385 CTTTAGGAAATGCAGGACTCAGG + Intronic
1195970216 X:110464660-110464682 CCTCAAGAACTCCTAGAATCAGG + Intergenic
1197272313 X:124438142-124438164 CTTCTAGAACTCCTGGCATCAGG + Intronic
1197773887 X:130107911-130107933 CTTTAAGAACTGGAGGTAGCTGG + Intronic
1199162481 X:144629183-144629205 CTGCAAGAACCGCAGGATTTTGG + Intergenic