ID: 961435339

View in Genome Browser
Species Human (GRCh38)
Location 3:126912781-126912803
Sequence TCTGAGGCCACGATGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 141}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961435330_961435339 20 Left 961435330 3:126912738-126912760 CCCAGGGGCTCACCTTCCACATT 0: 1
1: 0
2: 1
3: 19
4: 263
Right 961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 141
961435332_961435339 8 Left 961435332 3:126912750-126912772 CCTTCCACATTTACCTCCCAGTC 0: 1
1: 0
2: 5
3: 46
4: 357
Right 961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 141
961435337_961435339 -9 Left 961435337 3:126912767-126912789 CCAGTCAGCACTTCTCTGAGGCC 0: 1
1: 0
2: 4
3: 14
4: 225
Right 961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 141
961435334_961435339 -5 Left 961435334 3:126912763-126912785 CCTCCCAGTCAGCACTTCTCTGA 0: 1
1: 0
2: 3
3: 15
4: 223
Right 961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 141
961435333_961435339 4 Left 961435333 3:126912754-126912776 CCACATTTACCTCCCAGTCAGCA 0: 1
1: 0
2: 1
3: 11
4: 235
Right 961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 141
961435329_961435339 21 Left 961435329 3:126912737-126912759 CCCCAGGGGCTCACCTTCCACAT 0: 1
1: 0
2: 1
3: 38
4: 345
Right 961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 141
961435331_961435339 19 Left 961435331 3:126912739-126912761 CCAGGGGCTCACCTTCCACATTT 0: 1
1: 0
2: 2
3: 28
4: 322
Right 961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 141
961435336_961435339 -8 Left 961435336 3:126912766-126912788 CCCAGTCAGCACTTCTCTGAGGC 0: 1
1: 0
2: 4
3: 24
4: 207
Right 961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961435339 Original CRISPR TCTGAGGCCACGATGCAGCA GGG Intronic
900142865 1:1145810-1145832 TCAGAGGCCACAAAGCAGCATGG + Intergenic
902390294 1:16100117-16100139 TCTGAGATCAAGGTGCAGCATGG - Intergenic
903911960 1:26733996-26734018 TCTGAGGCCAGAATGCAGATAGG + Intronic
906001945 1:42434233-42434255 TCTGAGGGCATGATGCTGTACGG + Intronic
907412181 1:54290559-54290581 TCTGAGGCCACCATACTGCCGGG + Intronic
907558993 1:55371199-55371221 TCTGAGGCCATGAAGCATGAGGG + Intergenic
908245752 1:62226555-62226577 TCTGAAGCTACGGTCCAGCATGG + Intergenic
910568790 1:88677269-88677291 TCTGAGATCAGGGTGCAGCATGG + Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
920278579 1:204826816-204826838 TCTGAGCCCAGGATGAGGCAGGG + Intergenic
922068780 1:222170362-222170384 TCTGAGACTGCGGTGCAGCAAGG + Intergenic
922559751 1:226560671-226560693 TCTTAGGCCAAGCTGCAGAAGGG + Intronic
1062830715 10:603855-603877 TCAGAGGCCACCATGCAGCTTGG + Intronic
1063477720 10:6343384-6343406 TCTGAGGCCAGGATGTAGGCAGG + Intergenic
1063583382 10:7329719-7329741 TGTGAGGCCGCCATGCTGCATGG - Intronic
1067084662 10:43231435-43231457 TCTGGGGTCAGGAGGCAGCAGGG - Intronic
1067280246 10:44865488-44865510 GCTGCGGCCAGGGTGCAGCAGGG + Intergenic
1067799655 10:49350302-49350324 TCTGAGGCCACCATGCTGTGAGG + Intergenic
1068015814 10:51515383-51515405 TCTGATGACAAGTTGCAGCATGG + Intronic
1070588128 10:77781466-77781488 TTGGAGGCCAAGATGCTGCATGG - Intergenic
1076075698 10:127532129-127532151 TCTGTCGCCACAATCCAGCATGG - Intergenic
1076254086 10:129006306-129006328 TTTCAGGACAGGATGCAGCAAGG - Intergenic
1076424772 10:130359684-130359706 CCTGAGGCCACGTTGAAACAAGG + Intergenic
1079083922 11:17432102-17432124 TCTGAGGCCCCTGTGCAGAAAGG + Intronic
1081596215 11:44461313-44461335 AATGAGGCCACCATGCAGTAAGG - Intergenic
1083737071 11:64687492-64687514 CCTGAGGCCACAGGGCAGCAAGG + Intronic
1089614474 11:119687451-119687473 TCTGAGGCCAAGATTCAGGCAGG + Intronic
1092996480 12:13955892-13955914 TCTGGTGCCACCATGCAGCTGGG - Intronic
1093490664 12:19700809-19700831 TCTGAGGCCACGCTGCAAGCGGG - Intronic
1095491680 12:42741244-42741266 TCTGAGTCCATGATGCTGGAAGG + Intergenic
1099072336 12:78060945-78060967 TCTGGGGCCCTGATGGAGCAAGG - Intronic
1099832799 12:87866797-87866819 TCTGAGGACACAGTGCAGCTGGG + Intergenic
1102842043 12:116135300-116135322 TCTGAGGCCACTATGCTGAAAGG + Intronic
1104040029 12:125123622-125123644 TCTGAAGCCACGAGGCAACATGG - Intronic
1105604636 13:21916686-21916708 TCTGAGGGCAGGAAGCAGGAAGG - Intergenic
1105651451 13:22382629-22382651 TCTGTGGCCATGTAGCAGCAAGG + Intergenic
1112062753 13:95757483-95757505 TCTGATGACTGGATGCAGCAGGG - Intronic
1112389524 13:98970321-98970343 TCTGATAGCACAATGCAGCATGG + Intronic
1117435121 14:55708616-55708638 TCTGAGGTCAGGGTGCAGCATGG + Intergenic
1119294397 14:73521275-73521297 TCTGCAGCCACCAAGCAGCAGGG + Intronic
1121661612 14:95639434-95639456 CCTGAGGCCGCCATGCTGCAAGG - Intergenic
1122409813 14:101520128-101520150 ACTGAGGTCAAGATGGAGCAGGG - Intergenic
1122439058 14:101717793-101717815 TCTGAGACCACGGTGCAGGCAGG + Intergenic
1122837795 14:104438556-104438578 AATGAGGCCACCCTGCAGCAGGG + Intergenic
1125110284 15:36024363-36024385 TCTGAGGCCTCGATGCTCCCAGG + Intergenic
1129759992 15:78123796-78123818 TCAGAGGCCTCGATGCCACAGGG + Intronic
1131273333 15:90960058-90960080 TCTGAGGCCAGCATACAGCCAGG - Intronic
1132847158 16:2005918-2005940 TCTGAGGCCAGGGAGCAGCTGGG + Intronic
1133776979 16:8904319-8904341 TCCCAGGTCACCATGCAGCAGGG - Intronic
1140485310 16:75288775-75288797 TCTGCTGCCACGAGGCAGCATGG + Intergenic
1141640072 16:85335807-85335829 TCTGAGGCCTCCAAGCAGCCGGG + Intergenic
1142609739 17:1102266-1102288 TCTGTGGCCACGATGCCTCAGGG - Intronic
1146567397 17:33925073-33925095 TCTCTGGCCACCATGCTGCAGGG + Intronic
1148197170 17:45722333-45722355 CCTGAGGCCACTGTCCAGCAGGG + Intergenic
1155587628 18:27385756-27385778 TTTAAGGCCATGATGCAGTATGG - Intergenic
1156012363 18:32510021-32510043 TCTGGGGCCACAGAGCAGCATGG - Intergenic
1157888740 18:51394312-51394334 CCTGAGGACACCATGCTGCAAGG - Intergenic
1158553571 18:58457648-58457670 GCAGAGGCCATGAGGCAGCAGGG - Intergenic
1158806036 18:60974223-60974245 TCTGAGGCCATCAGCCAGCATGG + Intergenic
1160392224 18:78542777-78542799 TGTGAGGCCACGTCACAGCAAGG + Intergenic
1161003194 19:1921430-1921452 ACTGAGGACACGGTGCAGCAGGG + Intronic
1161221616 19:3120537-3120559 TCTGAGGCCTGGCTGCAGCAGGG + Intronic
1161390679 19:4018885-4018907 GCGGAGGCCCTGATGCAGCATGG + Intronic
1164754382 19:30679133-30679155 TCTGAGGCCACACAGCTGCATGG + Intronic
1165273752 19:34731885-34731907 TTAGAGGCCAGGAAGCAGCAGGG + Intergenic
1165768036 19:38362767-38362789 ACCGAGGCCTCGATGCAGCCGGG - Exonic
1165935868 19:39388707-39388729 TGTGAGGACAAGAGGCAGCAAGG + Intronic
1166212980 19:41319149-41319171 TCAGAGGCCAGGATGTAGCCAGG + Intronic
1166476533 19:43130797-43130819 TCTGAGGGCACGATTCTGCAGGG - Intronic
1168132156 19:54328488-54328510 CCTGAGGCCACCATGGAGCCCGG + Intergenic
925642456 2:5999072-5999094 TCTGAGACCAGGAGCCAGCATGG + Intergenic
927238285 2:20898226-20898248 TCTGATGTGAAGATGCAGCAGGG + Intergenic
929534085 2:42769808-42769830 TCTGAGCACACGATCCATCATGG - Exonic
936140543 2:109936298-109936320 TCTGAGATCAGGATGCGGCAGGG - Intergenic
936177234 2:110234243-110234265 TCTGAGATCAGGATGCGGCAGGG - Intergenic
936204151 2:110435188-110435210 TCTGAGATCAGGATGCGGCAGGG + Exonic
938043460 2:128095552-128095574 TCTGTTGCCCAGATGCAGCATGG + Intronic
938289756 2:130142931-130142953 TCTGAGGCAAAGATCTAGCAGGG + Intronic
938466770 2:131530007-131530029 TCTGAGGCAAAGATCTAGCAGGG - Intronic
939703853 2:145427645-145427667 ACTGAGGCCACGTTTCAGCATGG - Intergenic
942202159 2:173582277-173582299 GCAGAGGCTACGATGGAGCATGG - Intergenic
942787511 2:179716803-179716825 CCTAAGGCCACCATGCAGTAAGG + Intronic
943369880 2:187002967-187002989 TTGGAGGCCAAGATGCGGCATGG - Intergenic
943414081 2:187577095-187577117 TCTCAGGCCAGGATCCATCAAGG - Intergenic
948199970 2:236122467-236122489 TCTGAGGCCACTCAACAGCATGG - Intronic
1168799599 20:635602-635624 TCTGAGGCCAGCAGGCAGGAGGG - Intergenic
1170468714 20:16647075-16647097 ACTGAGGTCACAATACAGCATGG - Intergenic
1170500120 20:16966890-16966912 TCTGAGGCCCAGAAGAAGCAAGG - Intergenic
1172414661 20:34755144-34755166 TCTGAGGCCACGCCACAGCAAGG + Intronic
1173704105 20:45097631-45097653 TCTGAGGCCAGGTTGGAGCTGGG - Intronic
1174146417 20:48455538-48455560 TCTGGGGGCAGGAAGCAGCAGGG + Intergenic
1176075315 20:63245566-63245588 TCCCAGGCCTCCATGCAGCAGGG - Intronic
1178228124 21:30748239-30748261 TCTCAGGAGAGGATGCAGCAGGG - Intergenic
1178920864 21:36737337-36737359 CCTGAGGCCAGGCTGGAGCATGG - Intronic
1179168992 21:38958138-38958160 TTTGAGGCCAAGAGGGAGCAGGG + Intergenic
1180138807 21:45878323-45878345 TCTAAGGCCAAGAGGCAGAAGGG - Intronic
1181108991 22:20590523-20590545 TCTGAGGCAAAGACCCAGCAGGG + Intergenic
1183172932 22:36201432-36201454 TCTGGGGCCCCCATGCAACAAGG + Intronic
1183180342 22:36255547-36255569 TCTGGGGACTCCATGCAGCAAGG - Intronic
1184885018 22:47338404-47338426 TCTCAGGCCATGATGGATCAAGG - Intergenic
949141364 3:637239-637261 TGTGAGGCCAAGTTACAGCAGGG - Intergenic
950157009 3:10729192-10729214 TCTGAGGCCACCATGCTGTGAGG + Intergenic
960182539 3:114598067-114598089 TGTGAGGCCACAATTCAGCCAGG + Intronic
961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG + Intronic
964310273 3:155384969-155384991 GCCAAGGCCACAATGCAGCAAGG - Intronic
968267129 3:197370897-197370919 ACTGAGGCCAGGATGAAGCAAGG - Intergenic
972824143 4:42736994-42737016 TCTGAGCTCACTGTGCAGCAGGG + Intergenic
978916552 4:114132382-114132404 TCTGAGGCAACCAGGCACCAGGG - Intergenic
982037050 4:151356051-151356073 TCTTAGGTCACGATGCAGGAAGG - Intergenic
983297085 4:165879786-165879808 TCTGAGCTCAAGATGCTGCAGGG - Intronic
984489751 4:180417998-180418020 TCTGAGGGTTTGATGCAGCATGG + Intergenic
985616085 5:922849-922871 TCTGAGGCCACGCTGAGGAACGG - Intergenic
985641203 5:1064283-1064305 TCTGAGGCCAGGGTGCGGAAGGG + Intronic
985789213 5:1916268-1916290 TGTGGGGCCACCAGGCAGCATGG + Intergenic
987326805 5:16819962-16819984 TCTGAGCCCAGGAAGCAGCTGGG - Intronic
989354882 5:40532521-40532543 TCTGATGCCAGGATGCTGCTAGG + Intergenic
990017444 5:51082729-51082751 GCTGAGGGCAGGATACAGCAAGG - Intergenic
990431379 5:55738221-55738243 TCTGAGACCCCGAGGCAGAAAGG - Intronic
996016613 5:118546080-118546102 TCTGAGGCCACCATGCACTTAGG - Intergenic
997835635 5:137190833-137190855 ACTGAGGTCAAGATGGAGCAGGG + Intronic
1000834112 5:166134188-166134210 TCTGATGCCATGATGGAGGAGGG + Intergenic
1001124621 5:169008311-169008333 TCTGTGGCCATGAAGCTGCAAGG + Intronic
1003312584 6:4982585-4982607 TCTCAGGCCACGCTGCACCCAGG - Intergenic
1010985433 6:82418406-82418428 TCTGAGTCCAGGAAGCATCATGG + Intergenic
1015270901 6:131338081-131338103 CCTGAGGCCACTATGCTGTAAGG - Intergenic
1016360988 6:143267224-143267246 TCTGAAGCCACGTTGGAGAAGGG + Intronic
1016653684 6:146493272-146493294 TCTGAGATCAGGATGCAGCATGG + Intergenic
1020465610 7:8475258-8475280 TCTGGGGACACCAAGCAGCAGGG - Intronic
1021793555 7:24230059-24230081 TCTGTGGCCAAGATGCTGCCGGG + Intergenic
1021896708 7:25243390-25243412 ACTCAGGCCAAGATGCAGCTTGG + Intergenic
1022841044 7:34164095-34164117 GCTGAGGCCACGGTGCTGCCAGG + Intergenic
1023678002 7:42650928-42650950 TCTTAGGCCAAGAGCCAGCAGGG + Intergenic
1027035245 7:74920505-74920527 CCTGAGGCCACCATGCTGCAAGG + Intergenic
1027186117 7:75971816-75971838 TCTGAGGCCACCATGCAGGGAGG + Intronic
1029394808 7:100300635-100300657 CCTGAGGCCACCATGCTGCAAGG - Intergenic
1030593607 7:111510326-111510348 GTTGAGGACACGATGCCGCAGGG - Intronic
1031243134 7:119271091-119271113 CCTGAGACAATGATGCAGCAGGG - Intergenic
1032499692 7:132391205-132391227 CCTGATGCCACCTTGCAGCATGG - Intronic
1032743121 7:134759501-134759523 CCTGAGGACAAGAGGCAGCAAGG + Intronic
1033097021 7:138441090-138441112 CTGGAGGCCAAGATGCAGCATGG + Intergenic
1036157385 8:6355203-6355225 TGTGAGGCCAAGATGCAGGAGGG - Intergenic
1045437997 8:102183842-102183864 TCTGAGGCCAAGAGAAAGCAAGG + Intergenic
1045646633 8:104305777-104305799 TCTGAGGCCAAGGTGTCGCAGGG + Intergenic
1045664750 8:104472051-104472073 TCTGAGGCCCAGCTGCAGCCAGG - Intergenic
1047275285 8:123400966-123400988 CTGGAGGCCACGATGCGGCATGG + Intronic
1048861589 8:138727888-138727910 GCTCAGCCCACGATACAGCAAGG - Intronic
1048862659 8:138735728-138735750 ACTCAGGTCAGGATGCAGCAGGG - Intronic
1049196965 8:141320989-141321011 TCTGAGGCCCCAAAGCAGGAAGG + Intergenic
1049610964 8:143555103-143555125 TCTGAGGCCAGTATGCTGAAGGG - Exonic
1053273514 9:36766276-36766298 TCTCAGGCCACCAAGCAGCCCGG - Intergenic
1056808252 9:89745016-89745038 CCTGAGGCCACCATGCTGTAAGG - Intergenic
1056934398 9:90904799-90904821 TCTGTGCCCACGATGCCGTAAGG + Intergenic
1056940280 9:90949659-90949681 GCTGAGGGGACAATGCAGCAAGG - Intergenic
1057535186 9:95895652-95895674 TCTGAGGTCACTATGCTGTAGGG - Intronic
1059060468 9:111030621-111030643 TCTGAGACCCAGATGAAGCAGGG + Intronic
1060801851 9:126549971-126549993 TCTGAGGCCAGCACCCAGCAGGG - Intergenic
1062517281 9:136943041-136943063 TCAGAGGCCACCAGGGAGCAGGG + Intronic
1186186578 X:7026433-7026455 TCTGAGGGCACGATTCTGCAGGG - Intergenic
1189229020 X:39437529-39437551 TCTGAGGCCACCATGCTGTGAGG - Intergenic
1195433925 X:104820543-104820565 GCTGAGGTCACAATGTAGCATGG - Intronic
1200917940 Y:8587922-8587944 TGTGAGGCCAGGATGAAGGAAGG + Intergenic
1201590266 Y:15607079-15607101 TCTGAAGACACTCTGCAGCAAGG + Intergenic