ID: 961441675

View in Genome Browser
Species Human (GRCh38)
Location 3:126957280-126957302
Sequence GAGGGTTAAAAGGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 1, 2: 6, 3: 17, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961441667_961441675 21 Left 961441667 3:126957236-126957258 CCGTCCTCTCATTTCTAGAACGG 0: 1
1: 0
2: 0
3: 13
4: 156
Right 961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG 0: 1
1: 1
2: 6
3: 17
4: 159
961441666_961441675 28 Left 961441666 3:126957229-126957251 CCTGCGACCGTCCTCTCATTTCT 0: 1
1: 0
2: 0
3: 8
4: 83
Right 961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG 0: 1
1: 1
2: 6
3: 17
4: 159
961441665_961441675 29 Left 961441665 3:126957228-126957250 CCCTGCGACCGTCCTCTCATTTC 0: 1
1: 0
2: 0
3: 6
4: 75
Right 961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG 0: 1
1: 1
2: 6
3: 17
4: 159
961441670_961441675 17 Left 961441670 3:126957240-126957262 CCTCTCATTTCTAGAACGGGAAA 0: 1
1: 0
2: 0
3: 13
4: 150
Right 961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG 0: 1
1: 1
2: 6
3: 17
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961441675 Original CRISPR GAGGGTTAAAAGGATGCTGC TGG Intronic
901426372 1:9184141-9184163 GAGGGATAAAAGGAGGCAGATGG + Intergenic
901751370 1:11412176-11412198 GAGGGTGGAAAGGATGGTGGGGG - Intergenic
902334997 1:15749582-15749604 CACGGTTCAAAGGGTGCTGCTGG - Intergenic
903115494 1:21176158-21176180 GAAGGTGAAAAGGATACTGTTGG + Exonic
903906942 1:26694453-26694475 GAGGAAGAAAAGGCTGCTGCTGG + Intergenic
903988255 1:27245410-27245432 GAAGATTAAAAGCATGCTGAGGG - Intronic
904579920 1:31535286-31535308 CAGGGTCAAAAGTGTGCTGCGGG + Intergenic
905664929 1:39757651-39757673 GAGGGTTGGAAGGATGATGGTGG - Exonic
906129170 1:43445857-43445879 GAGGGATAAGAGGATGAGGCAGG - Intronic
907109641 1:51915112-51915134 GAGGGTTCAAATGATGCTAGTGG + Exonic
909595326 1:77399816-77399838 GAGGTTTAGAAGGCTGCTGTGGG + Intronic
910571646 1:88711774-88711796 GAGGGATAAAATGATGCTTGGGG + Intronic
910576433 1:88770228-88770250 CAGAGTTAAAAGAATGCTGTTGG - Intronic
911524203 1:98964494-98964516 GAGGGAAAAAAGGACTCTGCTGG + Intronic
916632887 1:166635936-166635958 GAGAGAAAAAAAGATGCTGCTGG - Intergenic
917804090 1:178598030-178598052 GAGGGTCAAAACCAGGCTGCTGG - Intergenic
920280614 1:204840679-204840701 GAGGGATCAAAGAATGCAGCTGG + Intronic
920361920 1:205424587-205424609 AAGAGTGAAAAGAATGCTGCAGG + Intronic
922152888 1:223020533-223020555 GAGGGAAAAGAGGATGCTGGTGG - Intergenic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
924112183 1:240711205-240711227 GAGGGGTCAGAGGATGCTGGAGG - Intergenic
1063933953 10:11057786-11057808 ATGGGTTAAAGGGATGATGCTGG - Intronic
1064276492 10:13910853-13910875 GAGGCTTAACAGGATGGTGTTGG - Intronic
1068036396 10:51765208-51765230 GAGGGAAAAAAGAATGCTGAGGG + Intronic
1069481712 10:68788881-68788903 GATGATTAAAAGGATGCAACAGG - Intronic
1069588742 10:69629143-69629165 GATGGATAAAAGGTGGCTGCTGG - Intergenic
1071196207 10:83163220-83163242 GAGTGATTATAGGATGCTGCAGG - Intergenic
1075702921 10:124480956-124480978 GGGGGTTATAAGGAGGCTGCAGG + Intronic
1076567367 10:131407910-131407932 GAGGGAGAAAAGGAGGATGCAGG - Intergenic
1077027163 11:445999-446021 CACAGTTAAAAGGAGGCTGCAGG - Intergenic
1079552584 11:21718672-21718694 GAGGCTTAACAGAATTCTGCTGG - Intergenic
1081238336 11:40673764-40673786 GAGGATTAAAAGGATTCCACAGG + Intronic
1084603611 11:70160532-70160554 GAGAGCTAGAAGGGTGCTGCTGG + Intronic
1088886486 11:114011551-114011573 AAGGGTTAAGAGGCTGTTGCAGG - Intergenic
1089533203 11:119145218-119145240 GAGGGTTAACAGGGTCCTGTGGG - Intergenic
1089600445 11:119611220-119611242 GTGGGCTAAAAGGATGGTGCAGG + Intergenic
1090342482 11:126037035-126037057 GAGGATTATAAGAATGCTGGGGG + Intronic
1090915212 11:131156956-131156978 GAGAGTTAAGAGGCTGCAGCTGG - Intergenic
1092941260 12:13409335-13409357 GATGGTTTCAAGGCTGCTGCTGG + Intergenic
1093548231 12:20372104-20372126 GTGGGTTAAATGAATGCTGCTGG - Intronic
1093839501 12:23879855-23879877 GTGGGTTAAAAGGATGCCATAGG + Intronic
1094488732 12:30945397-30945419 GAGTGTGTAAAGGATGCAGCTGG + Intronic
1095170421 12:39028330-39028352 CAGGGATAAATGGATGATGCAGG + Intergenic
1096805277 12:54137104-54137126 CAGTTTTAAAAGGAAGCTGCAGG - Intergenic
1098864439 12:75745915-75745937 GAGAATTAAGAGAATGCTGCAGG + Intergenic
1099083397 12:78215075-78215097 GATGTTTAAAAGGAAGCTTCAGG + Intergenic
1102064651 12:109963856-109963878 GAGGGAGATAAGGATCCTGCAGG - Intronic
1103934396 12:124467688-124467710 GAGGGTGATAAGGATGATGGAGG - Intronic
1105402885 13:20111114-20111136 CAGGATTAATAGGATGCAGCTGG - Intergenic
1108495476 13:51020397-51020419 GAGGGCAAAAAGGTGGCTGCAGG - Intergenic
1108508405 13:51133984-51134006 GAGCGTGCACAGGATGCTGCAGG - Intergenic
1110420707 13:75304635-75304657 GAGGGATAATAGGATGCTCTGGG + Intronic
1112929597 13:104717704-104717726 TAGGGTGAAGAAGATGCTGCTGG - Intergenic
1113435797 13:110290012-110290034 GTTGGCTGAAAGGATGCTGCCGG + Intronic
1116162468 14:41287487-41287509 CAGGGTGAAAAGGATACTGTTGG + Intergenic
1117337999 14:54771411-54771433 TAGGGTTAAAAGCATGGAGCTGG - Intronic
1118458069 14:65962723-65962745 GAAGGGTAAAAGGAGGCTGAGGG - Intronic
1120940201 14:89940613-89940635 GAGGGTTAAAAGTAAGTTCCTGG + Intronic
1122274778 14:100585989-100586011 AAGGGTTTGCAGGATGCTGCTGG + Intronic
1123427883 15:20187671-20187693 GAGTGTTGAAAGGGTGCTGATGG - Intergenic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1136856412 16:33662090-33662112 GAGTGTTGAAAGGGTGCTGATGG + Intergenic
1137314613 16:47303577-47303599 GAGGATTAAAAGGTTTCAGCAGG - Intronic
1138373194 16:56543538-56543560 GAGGGATCAAAGGAGCCTGCTGG + Intergenic
1139127795 16:64101165-64101187 GAGGGGAAAAAGGATGATGCTGG + Intergenic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1203117992 16_KI270728v1_random:1510567-1510589 GAGTGTTGAAAGGGTGCTGATGG + Intergenic
1144069304 17:11653365-11653387 CCGGGTTATAAGGATGATGCTGG - Intronic
1144077164 17:11729727-11729749 GAGGGGGACAAGGATGATGCTGG - Intronic
1145248315 17:21284234-21284256 GGGGGTTAAAAGTGCGCTGCTGG - Intergenic
1146626853 17:34441588-34441610 TAGGGCTCAAAGGCTGCTGCAGG - Intergenic
1147951082 17:44108444-44108466 TAGGGTTCTAAAGATGCTGCTGG + Intronic
1147998812 17:44375838-44375860 GAGGGTTGACAGGAGGCTGTGGG + Exonic
1148775734 17:50094983-50095005 AAGGGTTAAAAGGAGCCTGCAGG + Intronic
1151156305 17:72125233-72125255 GAGCCTTAAAACGGTGCTGCTGG + Exonic
1153537042 18:6113576-6113598 GAGGGTTCAAAGGAGCCTACAGG - Intronic
1160269480 18:77371591-77371613 TGGGGTAAAAAGGATGCTGTTGG - Intergenic
1160448942 18:78948872-78948894 GACGTGTAACAGGATGCTGCGGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1166369043 19:42291344-42291366 GAGGGTGAAACGGATGCTGGTGG - Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166869429 19:45862697-45862719 AATGGGTAAAAGGATGTTGCAGG + Intronic
1168054850 19:53857354-53857376 GATTGTTAAAAGGAGCCTGCCGG - Intergenic
927894846 2:26775136-26775158 GAGGGTTGAAGGGCTGCTGGGGG - Exonic
928229138 2:29481002-29481024 GATGGTTCAAAGGATCATGCCGG - Intronic
929931086 2:46256004-46256026 GAGGGTGCAGAGGCTGCTGCAGG - Intergenic
930767833 2:55103170-55103192 GAGTTTTAAAAGGATGCACCTGG + Intronic
931203391 2:60123125-60123147 GAAGGATAAAATGATGATGCAGG - Intergenic
931756833 2:65382114-65382136 AAGGGTTAAAAGGCAGCTACTGG + Intronic
932078483 2:68689213-68689235 GCAGGTTAAATGGAAGCTGCGGG + Intronic
932280616 2:70488914-70488936 GATGGTTAAAAGTAAGCTGACGG - Intronic
932480034 2:72033513-72033535 GAGGTTTAAAAGGATCCCTCTGG - Intergenic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933859325 2:86449076-86449098 TAGGGTTAAAAGTATTATGCAGG + Intronic
936344674 2:111666265-111666287 GAGGGTGGTGAGGATGCTGCTGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
940491589 2:154368848-154368870 GAGGGGTAACAAGATCCTGCTGG + Intronic
940644920 2:156381187-156381209 GTGGGATAAGAGGATGCTGGAGG + Intergenic
940654146 2:156468195-156468217 TATAGTTAAAAGGGTGCTGCTGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941658980 2:168175068-168175090 GAGTATTAAGAGGAGGCTGCAGG - Intronic
942548638 2:177091548-177091570 GAGGGATTGTAGGATGCTGCAGG - Intergenic
943634386 2:190289501-190289523 GAGGGATAAATGGTTGCTTCTGG + Intronic
944383475 2:199138545-199138567 GTCGGTTAAAAGAATGCTGGTGG + Intergenic
945092305 2:206186751-206186773 GTGGGTTAAAGAGGTGCTGCTGG + Intronic
945571572 2:211474016-211474038 GAGGATTAAAAGGGTGCAGCTGG + Intronic
945749747 2:213766853-213766875 CAGTGTTGAAAGGAAGCTGCAGG - Intronic
946565165 2:220956518-220956540 GAGGGATAAAGGGAAACTGCAGG - Intergenic
947824119 2:233092751-233092773 GAGGGATAAAGGGATGCTGTTGG - Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1178976937 21:37228138-37228160 CATGGTTAAGAGGATGCTGGGGG - Intronic
1183856137 22:40636404-40636426 GGGGGGAAAAAGGATGCTCCAGG + Intronic
1183970507 22:41474038-41474060 GAGGGTCAAAAGGAGGAGGCAGG + Intronic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
951781530 3:26368635-26368657 GAGGGTTTTAGGGATGCTGGAGG + Intergenic
954783303 3:53075692-53075714 GAAGGTTAAGATGATGCTGGGGG - Intronic
956452677 3:69390000-69390022 GAGGCTTAAGAAGATGCTTCGGG + Intronic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
962636047 3:137332363-137332385 GAGTGTCAAAAGAATGCAGCAGG + Intergenic
962764208 3:138546423-138546445 GAGCTTTAAAAGGATACTGAGGG - Intronic
963902176 3:150743312-150743334 GAAGGTCAAAAGGATGCAGTGGG - Intronic
964423891 3:156532259-156532281 GTGGGTTGAAAGGATGTTCCTGG + Intronic
967037927 3:185662010-185662032 GAGGGTTAGCAGGATGTGGCGGG + Intronic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
970410189 4:15798441-15798463 GAGGGTTGAAAGAGGGCTGCTGG - Intronic
970548575 4:17155603-17155625 CAGGATTCAGAGGATGCTGCTGG + Intergenic
973759554 4:54103723-54103745 GAGGCTGAAAAGGGAGCTGCCGG + Intronic
974299106 4:60041598-60041620 GGGGAATAAAAGCATGCTGCAGG - Intergenic
978550634 4:109921967-109921989 GAGGTTTAAAAACATGCTGAAGG + Intronic
984966351 4:185143462-185143484 GAGGGTCAAACTGCTGCTGCAGG + Exonic
986814686 5:11395862-11395884 GAGGGTTAACAGCCTGGTGCAGG - Intronic
991045423 5:62217989-62218011 GAGTGTTGAAAGGGTGCTGATGG - Intergenic
994800801 5:104371963-104371985 GATGGGTAAAAGGTAGCTGCTGG - Intergenic
995244870 5:109923939-109923961 GAAGGTTAAAAGGGTTCTGAGGG + Intergenic
996409317 5:123139888-123139910 GGTGGTAAAAAGGATGCTGCAGG + Intronic
997382948 5:133450419-133450441 GATGGCTAAAAGGAAGCAGCAGG - Intronic
1004067557 6:12263682-12263704 GAGGGTTAAATGGATTATTCTGG + Intergenic
1004966245 6:20855075-20855097 GAGTGTTAAAGGGACGCTGCTGG - Intronic
1006521357 6:34572982-34573004 GAGGGTTGAAAGGATGCTTTGGG - Intergenic
1006568417 6:34979824-34979846 GAAGTTTAAAAGGATTCTCCAGG - Intronic
1006751527 6:36380903-36380925 GAGAGTAAAAGGGATGCTGTGGG - Intronic
1007979331 6:46134440-46134462 TTGAGTTAAAAGGATGCTCCAGG - Intronic
1008237523 6:49068306-49068328 GAGGGTGAAAAGGATAGTGTGGG + Intergenic
1014326550 6:120003362-120003384 GAGGGTTAAAAACATTCTGCTGG - Intergenic
1015871017 6:137776409-137776431 GGGTGTTAAAAGGAGGCTTCCGG + Intergenic
1016560462 6:145390846-145390868 GAAGGTGAAAAGTTTGCTGCAGG - Intergenic
1018028796 6:159826082-159826104 GGGGGTTACGAGGATGCTGCTGG + Intergenic
1019786885 7:2982813-2982835 GAGGGTGAAAAGGTTCCTACTGG + Intronic
1025799671 7:64774074-64774096 CTGGGTTACAAGGATGCTGCTGG + Intergenic
1028280818 7:88925749-88925771 GAGAGTAGAAAGGATGGTGCAGG + Intronic
1031004013 7:116451869-116451891 GAGAGAAAAATGGATGCTGCAGG - Intronic
1031169842 7:118279183-118279205 TAGGGTAAAAAGGAGGCTGGTGG + Intergenic
1031755682 7:125638891-125638913 GAGGGTAAGAGGGATGATGCTGG - Intergenic
1033105622 7:138519566-138519588 GAGGGTTAGAGGGTTGCTACTGG - Intronic
1033277194 7:139980868-139980890 GAGGGGTAAAATGTTGCTGAGGG - Intronic
1035475254 7:159139263-159139285 CAGTGTCAAAAGGAGGCTGCTGG - Intronic
1037029317 8:14083457-14083479 GAGGGTTAAAAGGGTCCAGAGGG - Intergenic
1039880262 8:41621190-41621212 GTGGTCTAAACGGATGCTGCTGG + Exonic
1040510111 8:48085699-48085721 GAGGGTTACAAGGATGCTGCTGG - Intergenic
1042500750 8:69506330-69506352 AAGGGATAAGAGGATGGTGCAGG - Intronic
1044225956 8:89718324-89718346 AAGGGTTCTAAGGATGCTGTTGG + Intergenic
1045392917 8:101733056-101733078 GAGGGTGAAGAGGATGGTTCTGG - Intronic
1047426464 8:124751184-124751206 GAGGGTTCAAATGATGGTTCTGG - Intergenic
1048344688 8:133567805-133567827 GAGGGTTTTGAGGATGATGCTGG + Intronic
1049386725 8:142346670-142346692 GTAGGTCACAAGGATGCTGCTGG + Intronic
1050099138 9:2099859-2099881 GAGGGGTCAATGGATGCTGTTGG - Intronic
1052045062 9:23784333-23784355 GAAGGAAAAAAGGATGCTGTGGG + Intronic
1053369823 9:37551410-37551432 TAGATTTCAAAGGATGCTGCAGG - Intronic
1053453858 9:38215519-38215541 CAGTGTTAAATGGATGCTCCAGG - Intergenic
1055360497 9:75485014-75485036 GAGAGTAAAAAGGCTGCTGAAGG + Intergenic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1059297859 9:113288299-113288321 AAGGGTTAAGAAGATGCTACAGG - Intronic
1062276095 9:135731810-135731832 GAGGGTAAAGAAGATTCTGCAGG - Intronic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1187188390 X:17009768-17009790 GAGGGTTTAAAGGATGAGGATGG - Intronic
1191086867 X:56577645-56577667 GAGGGTTAACATGATGCCTCTGG + Intergenic
1195169888 X:102257011-102257033 GAGTGTTAAAAGGAGACTGGGGG - Intergenic
1195188969 X:102430089-102430111 GAGTGTTAAAAGGAGACTGGGGG + Intronic
1199171929 X:144742969-144742991 TAGGGTTAACAGGCTGTTGCAGG + Intergenic