ID: 961446964

View in Genome Browser
Species Human (GRCh38)
Location 3:126985436-126985458
Sequence CTGGCTGTGCAGAGGGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961446964_961446967 -7 Left 961446964 3:126985436-126985458 CCTACTGCCCTCTGCACAGCCAG No data
Right 961446967 3:126985452-126985474 CAGCCAGTGTTTCCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961446964 Original CRISPR CTGGCTGTGCAGAGGGCAGT AGG (reversed) Intergenic
No off target data available for this crispr