ID: 961450772

View in Genome Browser
Species Human (GRCh38)
Location 3:127001392-127001414
Sequence CAGCCTGAGCTGATGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 2, 2: 0, 3: 21, 4: 249}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961450772_961450787 27 Left 961450772 3:127001392-127001414 CCAGGGTCCATCAGCTCAGGCTG 0: 1
1: 2
2: 0
3: 21
4: 249
Right 961450787 3:127001442-127001464 GGGCCAGGGGCCATATCCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 211
961450772_961450779 -2 Left 961450772 3:127001392-127001414 CCAGGGTCCATCAGCTCAGGCTG 0: 1
1: 2
2: 0
3: 21
4: 249
Right 961450779 3:127001413-127001435 TGAAGGGGCTCTGCTACCAGGGG 0: 1
1: 0
2: 2
3: 10
4: 144
961450772_961450786 14 Left 961450772 3:127001392-127001414 CCAGGGTCCATCAGCTCAGGCTG 0: 1
1: 2
2: 0
3: 21
4: 249
Right 961450786 3:127001429-127001451 CCAGGGGCAAGAGGGGCCAGGGG 0: 1
1: 0
2: 5
3: 44
4: 521
961450772_961450782 7 Left 961450772 3:127001392-127001414 CCAGGGTCCATCAGCTCAGGCTG 0: 1
1: 2
2: 0
3: 21
4: 249
Right 961450782 3:127001422-127001444 TCTGCTACCAGGGGCAAGAGGGG 0: 1
1: 1
2: 0
3: 18
4: 197
961450772_961450783 12 Left 961450772 3:127001392-127001414 CCAGGGTCCATCAGCTCAGGCTG 0: 1
1: 2
2: 0
3: 21
4: 249
Right 961450783 3:127001427-127001449 TACCAGGGGCAAGAGGGGCCAGG 0: 1
1: 0
2: 1
3: 17
4: 275
961450772_961450781 6 Left 961450772 3:127001392-127001414 CCAGGGTCCATCAGCTCAGGCTG 0: 1
1: 2
2: 0
3: 21
4: 249
Right 961450781 3:127001421-127001443 CTCTGCTACCAGGGGCAAGAGGG 0: 1
1: 1
2: 1
3: 43
4: 242
961450772_961450784 13 Left 961450772 3:127001392-127001414 CCAGGGTCCATCAGCTCAGGCTG 0: 1
1: 2
2: 0
3: 21
4: 249
Right 961450784 3:127001428-127001450 ACCAGGGGCAAGAGGGGCCAGGG 0: 1
1: 0
2: 1
3: 37
4: 410
961450772_961450780 5 Left 961450772 3:127001392-127001414 CCAGGGTCCATCAGCTCAGGCTG 0: 1
1: 2
2: 0
3: 21
4: 249
Right 961450780 3:127001420-127001442 GCTCTGCTACCAGGGGCAAGAGG 0: 1
1: 0
2: 4
3: 19
4: 210
961450772_961450777 -4 Left 961450772 3:127001392-127001414 CCAGGGTCCATCAGCTCAGGCTG 0: 1
1: 2
2: 0
3: 21
4: 249
Right 961450777 3:127001411-127001433 GCTGAAGGGGCTCTGCTACCAGG 0: 1
1: 0
2: 2
3: 12
4: 138
961450772_961450778 -3 Left 961450772 3:127001392-127001414 CCAGGGTCCATCAGCTCAGGCTG 0: 1
1: 2
2: 0
3: 21
4: 249
Right 961450778 3:127001412-127001434 CTGAAGGGGCTCTGCTACCAGGG 0: 1
1: 0
2: 1
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961450772 Original CRISPR CAGCCTGAGCTGATGGACCC TGG (reversed) Intronic
900335911 1:2163348-2163370 CTGCCTGAGCTGTTGGAGACGGG + Intronic
900378638 1:2372973-2372995 CACCCTGAGGTGCTGGACCTGGG + Intronic
900393137 1:2442516-2442538 CAGGCAGAGCTGACGGGCCCAGG + Intronic
900563321 1:3319494-3319516 CAGCCTGGTCTGATGGCCTCAGG - Intronic
901851757 1:12020136-12020158 AACCCTGAACTCATGGACCCTGG + Intronic
902616664 1:17627349-17627371 CAGCCTGTCCGGATGGCCCCTGG - Exonic
903129371 1:21268701-21268723 GAGCCAGAGCTGATGGGCACGGG - Intronic
903776138 1:25795013-25795035 CATCCTGAGATGAGGCACCCTGG - Intergenic
903838397 1:26220745-26220767 CAGCCTGAGCTGAGGATACCTGG - Intergenic
903968847 1:27106217-27106239 CACTCTGGGCTGAGGGACCCAGG - Intronic
904318268 1:29680052-29680074 CAGCCTGAGCTGCTGGCCAGGGG + Intergenic
905469779 1:38183074-38183096 CAGTCTGAGCTTTTGGTCCCTGG - Intergenic
905893397 1:41530756-41530778 CAGCTGGGGCAGATGGACCCTGG - Intronic
906510333 1:46406932-46406954 CAGCCTCAGCTGCTGGCACCAGG + Intronic
907525833 1:55053493-55053515 CAGCTTGAGCTGTGCGACCCTGG - Intronic
907805723 1:57817514-57817536 CAGCCTGAGCTGAGAGCCCCAGG - Intronic
914322018 1:146574239-146574261 CATCCTGAGTTGATGTAACCTGG + Intergenic
914680686 1:149936445-149936467 CAGCTTCTGCTGATGGAGCCTGG - Intronic
914846775 1:151287842-151287864 CAGCCTCAGCTGGTGGGCTCAGG - Exonic
915471512 1:156128503-156128525 CAGCCTGAGCTGAAAGAAGCTGG - Intronic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
916562389 1:165944248-165944270 CAGGCTGCCCTGATGGACACAGG + Intergenic
919118435 1:193310418-193310440 CTGCCTGAGCTGAGGTGCCCTGG + Intergenic
920313457 1:205061851-205061873 CAGGCTGAGCTGTGGGAGCCCGG - Exonic
922972007 1:229750178-229750200 CAGCCTGGGCTGCTGGAGCTTGG - Intergenic
924535207 1:244929758-244929780 TAGCCTGTCCTGATGGACCTGGG - Intergenic
1064154755 10:12894660-12894682 CACACTGAGCTCAGGGACCCAGG + Intergenic
1064429339 10:15257570-15257592 CAGCCCCAGCAGATAGACCCTGG - Intronic
1065340015 10:24695924-24695946 GACCCTGAGCTGGAGGACCCAGG + Intronic
1066046904 10:31602915-31602937 CAGGCTGAGCCGGAGGACCCCGG + Intergenic
1066658014 10:37712829-37712851 CAGCCTCAGCTGCTGTCCCCAGG - Intergenic
1070720000 10:78749811-78749833 CAACCTGAGCTCTTGGACCTTGG + Intergenic
1070793410 10:79203103-79203125 CAGCATGGGCTGCTGGCCCCTGG + Intronic
1070882727 10:79863698-79863720 CAGCCTGAGCTCACAGGCCCTGG - Intergenic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1071457202 10:85860086-85860108 CAGCCTGGGCTGTTGGCCCCTGG - Intronic
1072743555 10:97924495-97924517 CACCCTGAGCTCTTGGCCCCTGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1075650138 10:124122386-124122408 CTGCCGCAGCTGATGGACCAGGG - Intergenic
1075963248 10:126587282-126587304 CAGCCTGAGCTGACTGATACAGG - Intronic
1077514785 11:2994965-2994987 CAGCCAGAGCTGAGGGCCACTGG + Intergenic
1080425914 11:32154160-32154182 TAGCCAGAGCTGATGGGCCCAGG - Intergenic
1080675341 11:34421236-34421258 CAGCATGAATTGCTGGACCCAGG - Intergenic
1084296521 11:68216008-68216030 CAGCCTCAGCTGAGAGGCCCAGG + Intergenic
1084642200 11:70432677-70432699 CTGCCTGTGCTGCTCGACCCTGG - Intronic
1084662992 11:70558070-70558092 CAGCCAGAGAGCATGGACCCCGG - Intronic
1085287942 11:75376271-75376293 CAACCAGAGCTTAGGGACCCTGG - Intergenic
1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG + Intronic
1092075044 12:5665810-5665832 CAGCCTCAGCTGATCCAGCCAGG + Intronic
1092946479 12:13458683-13458705 CAGCTTGGCCTGATGGAGCCAGG - Intergenic
1092976045 12:13745823-13745845 CAGCCTGAGCTGGGGATCCCTGG + Intronic
1096531753 12:52246987-52247009 CAGTCTGAGCTGCTGTAACCAGG + Intronic
1097102734 12:56600901-56600923 CAGCTTGAGCTGAAGAGCCCAGG - Intronic
1098208573 12:68138128-68138150 CAACCTGAGCTCATGGGCCATGG + Intergenic
1099573627 12:84356423-84356445 CTGGCTGAGATGATGGACCCAGG - Intergenic
1101660896 12:106764795-106764817 CAGTCTGCACTGATGGACCAGGG + Intronic
1102091749 12:110196008-110196030 AAGCCTGATCTGATGAACACAGG - Intronic
1102412758 12:112734609-112734631 CAGCTTGGGCTGCTGGACTCAGG + Intronic
1102587133 12:113931372-113931394 CAGCCACAGCTCATGGACCTGGG - Intronic
1103220009 12:119236169-119236191 AAGCCTGCCCTGATGGGCCCAGG + Intergenic
1103916168 12:124376725-124376747 CAGGCTGGGCTTATGGAACCAGG + Intronic
1104629730 12:130390497-130390519 AAACCTGGGCTGAGGGACCCCGG - Intergenic
1104642272 12:130475114-130475136 CAGCATGAGCTCATTGTCCCTGG + Intronic
1105007131 12:132728592-132728614 TGGCCTGAGCAGATGGAACCAGG + Intronic
1105987400 13:25581280-25581302 CAGCATGAGCTGATCTGCCCTGG + Intronic
1108520073 13:51238649-51238671 CAGCCTTACCTGTTGGACCATGG + Intronic
1109363320 13:61324404-61324426 AAGCCTCCGCTGGTGGACCCAGG + Intergenic
1110597352 13:77333934-77333956 CAGCCCCAGCTTGTGGACCCTGG + Intergenic
1112879859 13:104093709-104093731 CAACCTGAGAGGATGGCCCCAGG + Intergenic
1117477043 14:56106151-56106173 TAGCCTTAGCTGATGGGACCAGG + Intergenic
1117745916 14:58869453-58869475 CAGCCTGAGCTAATTTACACGGG + Intergenic
1120818837 14:88893034-88893056 CAGCCACAGCTGATGGGACCAGG + Intergenic
1122974336 14:105164896-105164918 CCTCCTGAGCTGATAGACGCAGG + Intronic
1123410729 15:20056658-20056680 CAGCCTGAGCTCATGACTCCTGG + Intergenic
1123520058 15:21063364-21063386 CAGCCTGAGCTCATGACTCCTGG + Intergenic
1127671301 15:61197608-61197630 CAGCCTCACCTGACGGAGCCCGG - Intronic
1127973296 15:63978966-63978988 CTGCCAGAGCTGCTGGGCCCAGG + Intronic
1128065159 15:64759980-64760002 CTACCTGAGCTGATAGACACAGG - Intronic
1129295782 15:74599325-74599347 CAGCGTCAGCTGGTGGATCCAGG - Intronic
1129745993 15:78021595-78021617 AAGCATGAGGTCATGGACCCAGG + Intronic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1132046173 15:98564493-98564515 CAGCCTGAGCTGAGGCATCAGGG + Intergenic
1132384287 15:101389234-101389256 CAGCCTGAGCTGACTAACCTGGG + Intronic
1132871384 16:2117184-2117206 GAGCCTGGGCTGGTGGGCCCTGG - Intronic
1133060271 16:3170473-3170495 CAGCCCCAGCGGATGGAACCCGG - Intergenic
1133454667 16:5931633-5931655 CAGCCTGACCTGTTTGATCCTGG - Intergenic
1133532633 16:6669846-6669868 CAGGCAGATCTGATGGAGCCAGG + Intronic
1133873743 16:9713719-9713741 AAGCCTGAGCTGTTGGACAATGG - Intergenic
1136395295 16:29989056-29989078 CTCCCTGAGCTGCTGGACCTGGG + Intronic
1138416924 16:56876877-56876899 CAGCCTGTGTTGCTGCACCCAGG + Intronic
1140687847 16:77450829-77450851 CAGCCTGAGCTGCTGGACCCTGG + Intergenic
1140720236 16:77764868-77764890 CAGCCTTATCTGATGGAGCTGGG + Intergenic
1140924047 16:79565996-79566018 CACCCTGCACTGATAGACCCTGG + Intergenic
1141453134 16:84119052-84119074 CAGCCTGAGCTACAGGATCCTGG + Intergenic
1141758841 16:86013497-86013519 CAGCCTCACCTGTTGTACCCTGG + Intergenic
1142159616 16:88550337-88550359 CAGCCAGCTCTGATTGACCCAGG + Intergenic
1142499355 17:323695-323717 CTGCCTGTCCTGATGGACACGGG + Intronic
1142671873 17:1491349-1491371 CGGCCTGGGCTGCAGGACCCAGG - Intronic
1143524529 17:7464332-7464354 AAACCTCAGCTGATGAACCCTGG + Intronic
1145244516 17:21259545-21259567 CAGCTTGAGCTGCTGGACTAAGG - Intergenic
1145302404 17:21649829-21649851 CTGCCAGATCTGCTGGACCCAGG + Intergenic
1145347914 17:22053483-22053505 CTGCCAGATCTGCTGGACCCAGG - Intergenic
1145415675 17:22711899-22711921 CTGCCAGATCTGCTGGACCCAGG + Intergenic
1148133642 17:45277644-45277666 CAAACTGAGCTGAGGCACCCCGG + Intronic
1148844460 17:50521075-50521097 CAGCCTGTGCTGAGGGTCCTTGG + Intronic
1152109078 17:78347476-78347498 GAGCCTGGCCTGATGGTCCCAGG + Intergenic
1152637156 17:81434913-81434935 CAGCCAGGGCTGGTGCACCCTGG + Intronic
1157509650 18:48261737-48261759 GAGCCTGAGCTGATGCCACCTGG - Intronic
1158846252 18:61445929-61445951 CAGCCTAGGCTGAGGGTCCCAGG + Intronic
1160569076 18:79804263-79804285 CAGCCACAGCCGCTGGACCCTGG + Intergenic
1160782745 19:885070-885092 GAGCCTGAGCTGCGGGACCCTGG + Intronic
1161013864 19:1973565-1973587 CAGCCAGGGCTGAGGGACCTGGG - Intronic
1162395847 19:10417762-10417784 CAGCCTGAGCCCTCGGACCCTGG + Intronic
1164122091 19:22275159-22275181 CAGCATTAGATGATGAACCCTGG - Intergenic
1165323654 19:35101265-35101287 AAGCCTGTGGTGATGGGCCCAGG + Intergenic
1166388124 19:42393446-42393468 CAGCCTTATGTGATGGACTCTGG + Intergenic
1166427174 19:42689248-42689270 CAGCTTAAGCTGCTGGAGCCAGG + Intronic
1166438711 19:42791714-42791736 CAGTTTGAGCTGCTGGAGCCAGG + Intronic
1166494505 19:43289440-43289462 CAGTTTGAGCTGCTGGAGCCAGG + Intergenic
1166520724 19:43478539-43478561 CAGCCAGAGCTGACAGAGCCAGG + Intronic
1166521101 19:43480792-43480814 CAGCCAGAGCTGACAGAGCCAGG + Intronic
1166679958 19:44759887-44759909 CTCCCAGAGCTGGTGGACCCAGG + Exonic
1166876475 19:45901025-45901047 CTGCCTGTGCTGATGACCCCAGG + Intronic
1168686351 19:58351654-58351676 CCGCCTGTGCTGATGCACCATGG - Exonic
925386925 2:3468361-3468383 CAGCCTGAGCAGCTGGACCAGGG - Intronic
930634863 2:53792926-53792948 CAGCCTGACCTCCTGGACTCAGG - Intronic
933846977 2:86334716-86334738 CAGCCTGAGCAGATGGGCTCTGG - Intronic
934514927 2:94980717-94980739 CAGTCGGACCTGCTGGACCCGGG + Intergenic
937939533 2:127274435-127274457 AAGCCTGAGCAGGTGGAACCTGG + Intronic
938575335 2:132598097-132598119 CAGCCTGATTTGCTGCACCCTGG + Intronic
939288828 2:140167089-140167111 CAACCTGAATTCATGGACCCAGG + Intergenic
941705886 2:168657700-168657722 CAGCCTGCCCTGCTGGCCCCGGG - Intronic
944051802 2:195478498-195478520 CAACCTGAGCAGAAGCACCCAGG + Intergenic
944342756 2:198622548-198622570 CAGCCTGAACTGAAGAACCCTGG - Intergenic
944793453 2:203157918-203157940 CAGCATTAACTGTTGGACCCTGG - Intronic
946090180 2:217215538-217215560 CAGCCTGAGCTTCTGGGCTCAGG + Intergenic
946138670 2:217669276-217669298 CACCCTGAGAGGATAGACCCAGG + Intronic
946674500 2:222144486-222144508 CAGCCTGGCCTCATGGACCCCGG + Intergenic
947268307 2:228306028-228306050 CAGTCTGAGTTGCTGGAGCCGGG + Intergenic
947574067 2:231258529-231258551 AAGCCTGAGCTACTGGACCGGGG - Intronic
948430675 2:237916577-237916599 CAGCCTTCTCTGATGGGCCCAGG + Intergenic
948591430 2:239053261-239053283 GATCCTGAACAGATGGACCCGGG - Intronic
948709581 2:239817478-239817500 GTGGCTGAGCTGATGGACTCAGG + Intergenic
1168754262 20:305184-305206 CAGCCTGTGCCCATGGACCTAGG + Intergenic
1170010050 20:11712979-11713001 CAGCGTGAGGTGATGGAGCCAGG - Intergenic
1170122841 20:12928730-12928752 CAGCCAGAGCTGATGAAGACAGG - Intergenic
1171518987 20:25761256-25761278 CTGCCAGATCTGCTGGACCCAGG + Intergenic
1172884567 20:38222536-38222558 GAGGCTGTGCTGAGGGACCCCGG - Exonic
1174743716 20:53040800-53040822 AAGGCTGAGCTGATGCAACCTGG - Intronic
1175160666 20:57005386-57005408 CAGCCTGAGCAGGTGCATCCTGG + Intergenic
1175892169 20:62320763-62320785 CAGCCTGTGCAGACGGGCCCAGG + Exonic
1177264400 21:18764715-18764737 CAGCCTGTGCCCATGGACCTAGG + Intergenic
1180087475 21:45514433-45514455 CTGCTGGAGCTGCTGGACCCAGG - Exonic
1180181760 21:46121311-46121333 CATCCTGCCCTGAAGGACCCAGG + Intronic
1181618167 22:24069614-24069636 AAGCCTGAGCTGATGCCTCCTGG - Intronic
1181630513 22:24148765-24148787 CAGCCTGAGCGGGTGGGGCCTGG - Intronic
1182061583 22:27402294-27402316 CATCCTGAGCAAATGGACCCAGG + Intergenic
1184490708 22:44807192-44807214 CAACCTGAGCTGAGGGATCATGG + Intronic
1184527529 22:45034295-45034317 CAGACTGAGCAGATCCACCCTGG + Intergenic
1184538953 22:45107152-45107174 CAGCCTGAGCTGATGGAGCCAGG + Intergenic
1184555938 22:45233142-45233164 CAGCCTGAGTTGGTGGCCACTGG - Intronic
1185073853 22:48672200-48672222 AAGCCTTAGCCGATGGACTCTGG + Intronic
951301277 3:21000198-21000220 CTGCCTGTGCTGATGGAGCAAGG + Intergenic
952509841 3:34042003-34042025 CAGCCTGTGCTGATTGAGGCAGG + Intergenic
953574892 3:44105098-44105120 CAGCCTGAGCTGGGAGACACTGG - Intergenic
953868952 3:46609628-46609650 CAGCCTGGCCTGATGCACCAAGG + Intronic
953913958 3:46906304-46906326 CAGCCTGGGCTGAGGGAGACAGG - Intergenic
954230576 3:49213702-49213724 CAGCCTGCGCCGCTGGCCCCAGG - Intronic
956124285 3:65996822-65996844 CACCCTGAACTGAAGGCCCCGGG + Intronic
956753702 3:72365300-72365322 CAGCCTCAGCTGATTGATTCTGG + Intergenic
957153548 3:76518214-76518236 CAGTATGACCTGAAGGACCCAGG + Intronic
958460906 3:94394089-94394111 CAGTCAGAGCTGCTGGACCTGGG - Intergenic
961450772 3:127001392-127001414 CAGCCTGAGCTGATGGACCCTGG - Intronic
961799191 3:129431939-129431961 AAGCCTGAACTGAAGGACCATGG - Intronic
962343974 3:134606500-134606522 CAGCCTCAGCTGAGGGGTCCGGG - Intronic
964053829 3:152427163-152427185 CAGCCTGAGAGAATGGGCCCTGG + Intronic
964679203 3:159318631-159318653 CAGCCTGCACTGATGGCCTCAGG - Intronic
964736759 3:159926002-159926024 GAGACAGAGCTGAAGGACCCAGG - Intergenic
964892278 3:161551580-161551602 CAGCCGTAGCTCATGGGCCCAGG + Intergenic
965993255 3:174845954-174845976 CAACCTGAGCTGATACACCATGG - Intronic
966688693 3:182722918-182722940 CAGCCTGAGCCGCTGGAGCCGGG + Intergenic
966912013 3:184564998-184565020 CAGCCAGGGCTCAGGGACCCTGG - Intronic
970303258 4:14703527-14703549 CAGCCTGAGCTGAAATACGCAGG - Intergenic
977055147 4:92182444-92182466 CTCCCTGGCCTGATGGACCCAGG - Intergenic
981114050 4:140969109-140969131 CAGCCTGAGCAAATGTAACCTGG - Intronic
984073088 4:175140706-175140728 CAGTCTGAGCTGTTGGAATCAGG - Intergenic
985141098 4:186840958-186840980 CTGCCGGAGCTGCTGGTCCCTGG + Intergenic
985164965 4:187083240-187083262 CAACCTCAGCTGATGGAAGCAGG + Intergenic
985824529 5:2182423-2182445 CAGCCTGAGCCAATGTACCCTGG + Intergenic
986245668 5:6004476-6004498 CATCCTGCGCTGATGGGTCCTGG + Intergenic
987250146 5:16092076-16092098 CAGACTGATCCGATGGACACTGG - Intronic
988167839 5:27617164-27617186 CAACCTGAGATGATGGAGCTTGG - Intergenic
989316269 5:40082497-40082519 CAGCCTGAGCTGACTAACACAGG - Intergenic
989561649 5:42858895-42858917 GAGCCTGTGCTCACGGACCCAGG - Intronic
990810114 5:59714038-59714060 CTGGCTGAGATGACGGACCCAGG - Intronic
991031215 5:62084282-62084304 CTGCCTGAGTTGATGGGCGCTGG - Intergenic
991986514 5:72292573-72292595 CACCCTGAGCTGCTGGAACTTGG + Intronic
994178997 5:96743474-96743496 CAGCCTGAGCTGATGGAGGTGGG - Intronic
995596463 5:113753379-113753401 CAGCCAGCGCTGCTGGCCCCGGG - Intergenic
995715941 5:115082040-115082062 CAGTCTGAGCTGCTGGAGCTAGG + Intergenic
999316570 5:150588152-150588174 CAGCCTGACTTTATGGACCCTGG + Intergenic
1000769509 5:165335214-165335236 CAGCATGCGCTGATGCTCCCAGG + Intergenic
1001732070 5:173968061-173968083 CAGCATCAGATGATAGACCCCGG - Intergenic
1002156649 5:177286836-177286858 CTACCTGAGCTGATGAACACAGG - Intronic
1002452989 5:179330298-179330320 CAGCCTGTCCTGATAGACTCTGG - Intronic
1002571094 5:180139810-180139832 CAGGCTGAGCTGCCGGGCCCTGG - Intronic
1003114786 6:3276603-3276625 CAGACAGAGCTGAGGGACCCCGG - Intronic
1005838540 6:29725080-29725102 CACCCTGAGGTGCTGGGCCCTGG + Exonic
1005852078 6:29829467-29829489 CACCCTGAGGTGCTGGGCCCTGG + Exonic
1005859448 6:29889378-29889400 CACCCTGAGGTGCTGGGCCCTGG + Intergenic
1005864596 6:29928102-29928124 CACCCTGAGGTGCTGGGCCCTGG + Intergenic
1005867012 6:29944171-29944193 CACCCTGAGGTGCTGGGCCCTGG + Exonic
1005905910 6:30261253-30261275 CACCCTGAGGTGCTGGGCCCTGG + Intergenic
1005915930 6:30351448-30351470 CACCCTGAGGTGCTGGGCCCTGG + Intergenic
1005932013 6:30491186-30491208 CACCCTGAGGTGCTGGGCCCTGG + Exonic
1006042927 6:31270414-31270436 CACCCTGAGGTGCTGGGCCCTGG - Exonic
1006052513 6:31355521-31355543 CACCCTGAGGTGCTGGGCCCTGG - Exonic
1006155674 6:32011652-32011674 CAGCGCGAGCTGATGGTGCCGGG - Intergenic
1006162005 6:32044506-32044528 CAGCGCGAGCTGATGGTGCCGGG - Exonic
1007193446 6:40039266-40039288 CAGCCTGATCAGAAGGACTCAGG + Intergenic
1010574028 6:77510419-77510441 CAGTTTGAGCTGCTGGAGCCAGG + Intergenic
1017919704 6:158860640-158860662 GAGCCTGAGCTGATGGAGACTGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018741397 6:166731863-166731885 TAGACTGAGGTGATGGCCCCGGG - Intronic
1019779012 7:2928973-2928995 CAGGCTGAGCTCAAGGCCCCCGG + Intronic
1021497616 7:21293320-21293342 AAGCCTGAGCTGCTGCACCCAGG + Intergenic
1021583310 7:22179936-22179958 CAGCTTGAGCTGCTGGACTAAGG - Intronic
1024063654 7:45716269-45716291 CAGCCAGCTCAGATGGACCCTGG - Exonic
1025016174 7:55440662-55440684 CTGCCTGGTCTCATGGACCCTGG + Intronic
1026428060 7:70316371-70316393 CAGCCATTGCTGATGGAGCCAGG + Intronic
1028251582 7:88544731-88544753 CAGCTTGAGCTGCTGAAGCCAGG + Intergenic
1029359181 7:100075824-100075846 CTGCCTGAGCAGATGGCCACAGG + Intronic
1030621822 7:111798293-111798315 CAGTTTGAGCTGCTGGAGCCAGG - Intronic
1033899238 7:146115994-146116016 CCGCCCCAGCTGATGGACCCCGG + Intergenic
1034842910 7:154416178-154416200 CAGCCTGAGATGCTGGACACAGG - Intronic
1035171287 7:157018773-157018795 CTGCCTGAGCTAATGGACGAGGG + Intergenic
1035325404 7:158062671-158062693 CAGCCAGCGCTGCTGGCCCCAGG + Intronic
1035592070 8:823843-823865 CAGCCCGGGTGGATGGACCCAGG - Intergenic
1036207516 8:6815910-6815932 CAGCATGACCTGCGGGACCCAGG + Exonic
1036427233 8:8655777-8655799 CAGCATGAGGTCCTGGACCCTGG + Intergenic
1036658330 8:10691870-10691892 CGGACTGAGCTGGGGGACCCAGG - Intronic
1036774229 8:11599068-11599090 CAGCCTGAGCTGATTAATGCAGG + Intergenic
1037805380 8:22055663-22055685 CAGGCTGAGCTGCTGCAGCCAGG - Intronic
1038190978 8:25320230-25320252 CAGAAAGAGCTGATGGAGCCCGG - Intronic
1038699377 8:29835595-29835617 CAGAGTGAGGTGATGGGCCCTGG - Intergenic
1039334639 8:36575732-36575754 CTGGTTGAGATGATGGACCCAGG + Intergenic
1040419186 8:47223129-47223151 CAGTCTGGCCTGATGGACACAGG - Intergenic
1040552273 8:48446658-48446680 CACCCTGTGCTGTGGGACCCTGG + Intergenic
1040558938 8:48506513-48506535 CGCCCTGAGCTGAGGGCCCCGGG + Intergenic
1041110335 8:54477231-54477253 CAGCCTGAGCAGCTGGAGCAGGG + Intergenic
1046325955 8:112647100-112647122 CTGCCTGAGATCATAGACCCTGG - Intronic
1048526924 8:135211707-135211729 CAACCTGATATGATGGGCCCTGG + Intergenic
1049277384 8:141726550-141726572 GAGCCTGAGCTGCGGGAACCAGG - Intergenic
1049613136 8:143565060-143565082 CAGGTGGATCTGATGGACCCTGG + Intergenic
1053121210 9:35548448-35548470 CTGGCTCAGCTGATGGATCCAGG + Exonic
1053352916 9:37425029-37425051 CAGCCTGTGCTGCTGGCTCCTGG + Intronic
1057030989 9:91775162-91775184 CAGCCTGAGCTGACTGAGACAGG + Intronic
1057122876 9:92593032-92593054 CAACCAGAGCTGCTGGCCCCAGG + Intronic
1058829162 9:108799888-108799910 CACCCTGAGCTGTTTCACCCTGG - Intergenic
1060766714 9:126299564-126299586 CAGCCTGAGCTATTTGACCAGGG + Intergenic
1061885963 9:133591260-133591282 AAGCCTGCTGTGATGGACCCAGG - Intergenic
1062153217 9:135032150-135032172 GAGCCAGAGCAGATGCACCCTGG + Intergenic
1062153391 9:135032937-135032959 GAGCCAGAGCAGATGCACCCTGG - Intergenic
1189885563 X:45540962-45540984 CAGCCTGGGCTAATGGAGCTGGG + Intergenic
1193348223 X:80429049-80429071 CAGTCTGAGTTGATGGAGCCGGG + Intronic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1194105172 X:89759685-89759707 CAGTCTGAGTTGCTGGAGCCGGG + Intergenic
1198186188 X:134256182-134256204 GAGTCTGTGCTGTTGGACCCAGG + Intergenic
1199593451 X:149488715-149488737 CAGCCTGTGCTGCTGCAGCCAGG + Intronic
1199598566 X:149526716-149526738 CAGCCTGTGCTGCTGCAGCCAGG - Intronic
1199927813 X:152487179-152487201 CAGACTGAGCTGGTGGAAGCTGG - Intergenic
1200457131 Y:3407502-3407524 CAGTCTGAGTTGCTGGAGCCGGG + Intergenic
1200507835 Y:4036441-4036463 CAGCCAGACCTCATGGATCCAGG - Intergenic