ID: 961451611

View in Genome Browser
Species Human (GRCh38)
Location 3:127004747-127004769
Sequence GGGCCATGGTGGTCTCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961451595_961451611 24 Left 961451595 3:127004700-127004722 CCTGCACAGCATGTGAGTCTGGG 0: 1
1: 0
2: 1
3: 15
4: 158
Right 961451611 3:127004747-127004769 GGGCCATGGTGGTCTCACAGTGG 0: 1
1: 1
2: 1
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961451611 Original CRISPR GGGCCATGGTGGTCTCACAG TGG Intronic
900678203 1:3901322-3901344 GGGCCAACGTGGACTCGCAGGGG + Intergenic
901599063 1:10408212-10408234 AGGCCACCGTGGTCTCCCAGGGG + Intronic
902112612 1:14095222-14095244 GGGCCATGTGGCTCTCCCAGTGG - Intergenic
904902070 1:33865338-33865360 GGGCCAGGGTGAACTCCCAGGGG + Intronic
906606251 1:47174438-47174460 GGGTGATGGTGGACTAACAGAGG - Intergenic
907426042 1:54379961-54379983 GGGCACTCCTGGTCTCACAGTGG + Intronic
907999132 1:59663415-59663437 TGGCCAGGATTGTCTCACAGAGG + Intronic
912869532 1:113291353-113291375 GGGCCATCGTCTTCCCACAGAGG - Intergenic
914429277 1:147605376-147605398 GGGCCATGGAGGACATACAGAGG + Intronic
916412406 1:164559301-164559323 GGGCCAGAGTGATCTCAAAGGGG - Intronic
917297620 1:173538270-173538292 GGGACATAGTTTTCTCACAGTGG - Intronic
920716068 1:208341616-208341638 GGTCTCAGGTGGTCTCACAGTGG - Intergenic
920866773 1:209759839-209759861 AGGACATGGTGGTATCAAAGTGG - Intronic
924897151 1:248352026-248352048 GAACCATGTTGGACTCACAGTGG - Intergenic
1062996379 10:1870625-1870647 GGGCCATGGGGGGATCACTGAGG + Intergenic
1067536132 10:47111570-47111592 GGGGCATGGTGGTTACACACAGG + Intergenic
1068804142 10:61175633-61175655 AGGCCTTGGTGTTCTCACAAGGG + Intergenic
1069589448 10:69632804-69632826 GGGCCATGGTGCTCCCCCAGGGG + Exonic
1070760315 10:79020222-79020244 AAGCCATTGTGGTGTCACAGGGG - Intergenic
1070803315 10:79256033-79256055 GGGCCCTGGGGGGCTCCCAGTGG - Intronic
1070934676 10:80283965-80283987 TGGCCATGGTGGACTACCAGCGG - Exonic
1074058523 10:109943698-109943720 GGTCCCTGGTGGTCTCTCTGTGG - Intronic
1075416956 10:122271325-122271347 GGGCCAAGGTGCTTTGACAGGGG - Exonic
1076462486 10:130656281-130656303 TGGCCATGGTGGTCTTGCTGCGG + Intergenic
1076525545 10:131110390-131110412 TGGCCCTGGTGGTCTCACCCCGG + Intronic
1076858772 10:133129874-133129896 GGGCCATGCTGGGGTCTCAGTGG - Exonic
1077013904 11:391696-391718 GGGGCATGGTGGGCTCAGCGTGG - Intergenic
1077208127 11:1353783-1353805 GGGCCATGGTGACCTCTCTGGGG - Intergenic
1077996873 11:7460979-7461001 GGGCATTGGTTGCCTCACAGGGG + Intronic
1079137500 11:17784178-17784200 GTGCCCTGGTGGACTCAAAGTGG + Intergenic
1080847262 11:36037127-36037149 GGCACAGGGTTGTCTCACAGGGG + Intronic
1083925636 11:65804341-65804363 GGGCTGTGGTGGCCCCACAGAGG - Intergenic
1085083653 11:73652694-73652716 GGGCTTGGGTGGTCTCTCAGGGG - Intronic
1085267066 11:75243239-75243261 GGGGCATCGTGGCCTCAGAGAGG + Exonic
1085300523 11:75455759-75455781 GGGCCCTGGTGGGCACAGAGTGG - Intronic
1085404652 11:76254743-76254765 GGGGCATGGGGGTCCCACACTGG - Intergenic
1086157528 11:83684010-83684032 AAGCCAAGATGGTCTCACAGTGG - Intronic
1086560617 11:88164268-88164290 GTGCCATGGTGAACTCACATGGG + Intronic
1088822043 11:113464679-113464701 AGGCAATTGTGGTCACACAGTGG - Intronic
1089673442 11:120073083-120073105 GGGTCAGGGAGGTCTCCCAGGGG + Intergenic
1089683122 11:120130496-120130518 GAGCAATGGTGGGCTCAGAGGGG + Intronic
1090970811 11:131641474-131641496 GATCCATGGAGGTCTCAGAGAGG - Intronic
1091380310 12:53880-53902 GGGCCTTGAAAGTCTCACAGCGG - Intergenic
1091544180 12:1489753-1489775 GGGGCATGGTGATCTCAGAGAGG - Intronic
1097119550 12:56720866-56720888 AGGCCATGGGAGTCACACAGTGG + Exonic
1098388955 12:69949020-69949042 GGGTAATGCTGGGCTCACAGTGG - Intronic
1103629831 12:122251127-122251149 AGGCCATGGGGGCCTCCCAGGGG + Intronic
1103852131 12:123940164-123940186 GGGCCCTGGTGGTCGGACTGGGG + Intronic
1109984004 13:69951597-69951619 TGGGTATGGTGGCCTCACAGAGG - Intronic
1110122189 13:71895875-71895897 GGGACAGGATGGGCTCACAGAGG - Intergenic
1112429945 13:99342571-99342593 TGGCCATGGTGGTAGCACAGAGG - Intronic
1112617469 13:101020079-101020101 GTTCCATGGTGGTGACACAGTGG - Intergenic
1113738880 13:112697220-112697242 GGGCCACGGTGGGCTCCTAGTGG + Intronic
1114722028 14:24892711-24892733 GGGCCATGCTGTTCCCACACTGG + Intronic
1116161095 14:41267748-41267770 TGGCCATAGGGGTCTCACTGAGG + Intergenic
1119805162 14:77477657-77477679 TGGCCATGGTGCTGGCACAGGGG - Intronic
1122004306 14:98689234-98689256 GGGCCTTGATGGGATCACAGGGG + Intergenic
1122697178 14:103561916-103561938 AGGCCATTGTGGACTCCCAGTGG - Exonic
1124227611 15:27907893-27907915 AGGCCAAGATGGTCTCACAGGGG + Intronic
1125523627 15:40361941-40361963 GGGCCATGGGGGGTTCCCAGAGG - Intronic
1125773014 15:42184586-42184608 GGGCCAGGATGATCTCACCGTGG - Exonic
1129100121 15:73253956-73253978 GGGCCATGTTTGCCTCTCAGAGG + Intronic
1129220542 15:74129417-74129439 GGGCCATGGGGGTCTCTCGATGG - Exonic
1129234215 15:74214118-74214140 GGGCCATGGGGGTGTGTCAGCGG + Intergenic
1129376941 15:75139502-75139524 GAGCCTTGGTGCTCTCACTGGGG - Intergenic
1131995801 15:98131690-98131712 GGGCCATTGTTGTGTCACAGTGG - Intergenic
1132470098 16:97789-97811 GGGCCATGGGGGTCTCACAGTGG - Intronic
1132594510 16:742296-742318 AGCCCATGGAGATCTCACAGTGG + Intronic
1133170563 16:3980375-3980397 GGGCCATGGTGGGGCCACATGGG + Intronic
1133839890 16:9398228-9398250 TGGGAATGGTGGTCTCACTGTGG + Intergenic
1134218223 16:12332914-12332936 TGGCCATGAGGGTCTCAAAGCGG - Intronic
1135096325 16:19567670-19567692 GGGCCAGGGCTGTCTCACTGAGG - Intronic
1135486706 16:22871889-22871911 GGGCCAGGGTGGGCTCACCTGGG + Intronic
1136382476 16:29901880-29901902 GGGCATTGGTGGGCCCACAGCGG - Exonic
1140225055 16:73070523-73070545 GCGACAAGGTGGTCTCAGAGTGG - Intergenic
1142005889 16:87689453-87689475 GGACCACGGGGGTCCCACAGAGG + Intronic
1146305533 17:31727252-31727274 AGGCCTTGGTGATCTCACAGGGG + Intergenic
1146722995 17:35136443-35136465 GGGCCATGGTGTTCACCCAGTGG + Exonic
1147171178 17:38619985-38620007 GGGCTTTGCTGGTCTCACAGGGG - Intergenic
1147360105 17:39924989-39925011 GGGCCCTGGTGGTTTGGCAGTGG - Intronic
1147882463 17:43662907-43662929 GCGCCCTGCTGGTCTCTCAGAGG + Intergenic
1151881230 17:76896014-76896036 GGGCCTTGGTGTTGTCACCGTGG - Intronic
1152647673 17:81477251-81477273 GGGCCCTGGGAGTCTCAAAGGGG - Intergenic
1157117347 18:44874525-44874547 GGACCGTGGGGGTATCACAGAGG + Intronic
1157480215 18:48049158-48049180 GGGGCACTGTGGTCTAACAGAGG - Intronic
1160265267 18:77336422-77336444 GGACCCTGGTGTCCTCACAGGGG + Intergenic
1160402552 18:78621433-78621455 GGGGCATGGAAGTCCCACAGTGG + Intergenic
1161218155 19:3105033-3105055 GGAACCTGGGGGTCTCACAGCGG + Intronic
1161401846 19:4069317-4069339 GGTCCATGCCCGTCTCACAGAGG - Intergenic
1161852347 19:6744355-6744377 GGGCCAGGGGGATCTCAGAGGGG - Intronic
1162425953 19:10595803-10595825 GGGGTATGGGGGTGTCACAGGGG - Intergenic
1162766772 19:12924596-12924618 GGGCCATGGTGGTGAGGCAGCGG - Intronic
1163516949 19:17770570-17770592 TGGACAAGGTGGGCTCACAGTGG + Exonic
1163704367 19:18803758-18803780 GGGCCAAGGTGGGATCACATGGG + Intergenic
1164880103 19:31725740-31725762 GGGTAACGGTGGTCTCACACTGG + Intergenic
1165793925 19:38507561-38507583 GGGGCATGGGGGACTCAGAGTGG + Intronic
1166852774 19:45768434-45768456 GGGCCCTGGTGGCCTTCCAGCGG - Exonic
1167156448 19:47742013-47742035 GGACCATGGGGGGCTCAGAGGGG + Exonic
1167577487 19:50324833-50324855 GGGCAGTGGTGGTGCCACAGAGG + Intronic
1168483003 19:56737149-56737171 GGAGGATGGTGGGCTCACAGAGG - Intergenic
927044624 2:19264388-19264410 GGGCCATTGTGGGCTCAAAGTGG + Intergenic
928081365 2:28315272-28315294 GGGCCTTGGCTTTCTCACAGAGG + Intronic
928256322 2:29726040-29726062 TGGCCAAGGTGGACTCACACTGG + Intronic
929557519 2:42934806-42934828 GGGCCATAGTGGACTCAGAGAGG + Intergenic
929788082 2:45006225-45006247 AGGCCATGGTGGTGTTGCAGTGG + Exonic
936478978 2:112867835-112867857 GGTCCATGGTGGACTCACCTGGG + Intergenic
1169198848 20:3697837-3697859 GGGCATTGCTGGCCTCACAGAGG + Exonic
1169900521 20:10547909-10547931 GGCCCATAGTGGACTGACAGAGG + Intronic
1170125587 20:12959904-12959926 GGGCAATGGTGCTCCTACAGTGG - Intergenic
1170126264 20:12967621-12967643 GGGCAATGGTGCTCCTACAGTGG - Intergenic
1172168889 20:32916987-32917009 GGGACATTGTGGCCTTACAGAGG - Intronic
1174048689 20:47752173-47752195 GGCCCAGGGTGCTCTAACAGAGG + Intronic
1174545388 20:51321417-51321439 AGGCCATGGTGGGCAGACAGAGG + Intergenic
1175093670 20:56524706-56524728 GGCCCTTGGTGATGTCACAGAGG - Exonic
1175094861 20:56533239-56533261 GGCCCTTGGTGATGTCACAGAGG - Exonic
1175432611 20:58916837-58916859 AGGCCCAGGTGGTTTCACAGGGG + Intergenic
1176196354 20:63837868-63837890 TGGCCATGGTGGGATGACAGGGG + Intergenic
1177260811 21:18726957-18726979 GGGCAATGCTGGCCTCATAGAGG - Intergenic
1179805760 21:43835935-43835957 GGGCCATAGTGGTCCCACGAAGG - Intergenic
1179993174 21:44959118-44959140 GGGCCTTGGAGGTTTCACACCGG + Intronic
1181316022 22:21971336-21971358 CGGCCATGGTGCCCTCACAGTGG - Intronic
1182356233 22:29723382-29723404 CAGCCATGGTGGGCACACAGAGG - Intronic
1183126282 22:35784746-35784768 GGGCCATGGTGGTGGCCCATGGG + Intronic
1183281724 22:36935941-36935963 GGGACAGGGTGGGCTCACAGAGG + Intronic
1183711140 22:39504215-39504237 GGGCCATGGGGGACTGGCAGGGG - Exonic
1185019849 22:48367743-48367765 GGCACATGGTGGCTTCACAGTGG - Intergenic
949109070 3:236775-236797 GGGCCATGGGATTCACACAGAGG - Intronic
954438657 3:50509595-50509617 GGGCCAGGGTCCTCTCAAAGAGG - Intergenic
954537515 3:51372410-51372432 GGGCTATGGTGGCCACAAAGGGG - Intronic
955677085 3:61460119-61460141 GGGGAATGGAGGTCTCCCAGGGG - Intergenic
960518220 3:118625335-118625357 GGGCCATGATGGTCTCAGCCAGG + Intergenic
961345147 3:126259466-126259488 CGGCCTGGCTGGTCTCACAGTGG + Intergenic
961451611 3:127004747-127004769 GGGCCATGGTGGTCTCACAGTGG + Intronic
961601780 3:128068024-128068046 GGACCATGGAGGTCTCTCGGTGG - Exonic
961644891 3:128387696-128387718 GGGTCTTGGTGGTGCCACAGGGG - Intronic
963766663 3:149343301-149343323 GGGCCATGGTGGGGACACACTGG + Intergenic
967435991 3:189446869-189446891 GGTCCATGATGGGCACACAGGGG + Intergenic
967873832 3:194252887-194252909 GGGCGATGGTGGTGACAGAGAGG + Intergenic
971902559 4:32681090-32681112 GGCGCATGATGTTCTCACAGTGG + Intergenic
977981013 4:103321848-103321870 TGGCCCTGTTTGTCTCACAGTGG + Intergenic
979226059 4:118286286-118286308 GGGCCAGGCTGGTATCAGAGAGG - Intronic
982103227 4:151989176-151989198 GGGGCATGATAGTCACACAGAGG - Intergenic
985303607 4:188515073-188515095 CGGCCTTGGTGGGCCCACAGTGG - Intergenic
985731873 5:1553923-1553945 GGGACAGGGTGGGCTCTCAGGGG + Intergenic
986338430 5:6771214-6771236 CGGGCAGGGTGGTTTCACAGAGG - Intergenic
989060067 5:37401666-37401688 TGGCCATGCTGGTCTCACCTGGG + Intronic
990411762 5:55548210-55548232 GAGCCATGGTGCTCACACATAGG - Intergenic
997422278 5:133779035-133779057 GGCCACTGGTGGTCCCACAGAGG - Intergenic
997658482 5:135572754-135572776 GGCCCATGGGGGCCACACAGAGG - Intronic
999633863 5:153599920-153599942 GGTACATGGTGGAGTCACAGGGG + Intronic
1001514591 5:172346427-172346449 GGGCCAGTGAGGTCTCACCGAGG - Intronic
1002028952 5:176414211-176414233 GGAAAAGGGTGGTCTCACAGAGG + Intronic
1002071123 5:176679560-176679582 GGACCCTGGTGGTCTAAGAGGGG - Intergenic
1002421473 5:179151487-179151509 GGGCCAAGGTGGTCTCAGTGGGG + Intronic
1002931042 6:1635370-1635392 GGGCCATGTTGGTTGCGCAGTGG - Intronic
1012636888 6:101554212-101554234 GGGCCTGGTTGGTCTCACATTGG - Intronic
1019504826 7:1385592-1385614 GGGCCTGAGTGGGCTCACAGCGG - Intergenic
1019522278 7:1466364-1466386 GGGCCCTGCTGGGCTCACGGGGG - Intergenic
1020205445 7:6111430-6111452 GGGGCTTGGTGGTTTCAGAGAGG + Intronic
1020286150 7:6682677-6682699 GGGCCATGGTGATGTCCCTGGGG - Intergenic
1024215957 7:47248170-47248192 TGGCCTTGGTGGTCTCCCTGTGG - Intergenic
1025724625 7:64045529-64045551 GGGCTATGGTGGAGTCACCGAGG - Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1031998258 7:128246982-128247004 GGAAGATGGTGGGCTCACAGTGG - Intronic
1036638314 8:10566365-10566387 CGCCCATGGGGTTCTCACAGTGG + Intergenic
1037825743 8:22159746-22159768 GGGCCATGTTGTTCTCACGTGGG - Intronic
1040951447 8:52941428-52941450 AGGCCAAGCGGGTCTCACAGGGG - Intergenic
1041249933 8:55924241-55924263 GTGCCATGGTGAAGTCACAGAGG - Intronic
1041699489 8:60772595-60772617 GGTCCATAGTGTTCTCAAAGAGG - Intronic
1044484040 8:92728912-92728934 GGGCCATGGTGGAAAGACAGAGG + Intergenic
1045377579 8:101590514-101590536 GGGCCCTGCTAGTCTCATAGTGG - Intronic
1047878966 8:129171450-129171472 GGTGCATGGTGGTCACACTGTGG + Intergenic
1049824681 8:144661163-144661185 GGGCCATGGTGGTCCCGGAGTGG - Intergenic
1055424190 9:76176682-76176704 GGGCCTTGGTGCTCTTATAGTGG + Intronic
1057185396 9:93054892-93054914 GGGCCATGGTGGCCTGGGAGGGG - Intergenic
1057623415 9:96655921-96655943 GGGCCAGTTTGGTCTCACAAAGG - Intergenic
1057694768 9:97315311-97315333 GGGCTACGGTGGTCTCAGGGTGG + Intronic
1058803729 9:108569663-108569685 GGGCCATGGTGGTTTTACAGAGG - Intergenic
1059386926 9:113971879-113971901 GCGCCATGGTAGTAACACAGGGG - Intronic
1060723087 9:125990962-125990984 TGGCCAGTGTGGTCTCAGAGGGG - Intergenic
1187595324 X:20765361-20765383 GGGGCCTAGTGGTCTGACAGAGG + Intergenic
1191690435 X:63933296-63933318 GGGCCATTGAGGCCTCACTGTGG - Intergenic
1200344482 X:155435250-155435272 AGGCCCTGGTGGGCTCACAAGGG - Intergenic
1201062306 Y:10058615-10058637 GGGGCATGGGGGTGTCTCAGTGG + Intergenic
1202115260 Y:21465656-21465678 GGGCCTCGGTGGTGTCTCAGTGG - Intergenic