ID: 961455661

View in Genome Browser
Species Human (GRCh38)
Location 3:127022694-127022716
Sequence TCCAGCTGTCCAGCAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961455661_961455667 23 Left 961455661 3:127022694-127022716 CCTGTGCCTGCTGGACAGCTGGA 0: 1
1: 0
2: 0
3: 27
4: 333
Right 961455667 3:127022740-127022762 TGTGCTCCCCAGGACTGAGTCGG 0: 1
1: 0
2: 0
3: 34
4: 211
961455661_961455664 13 Left 961455661 3:127022694-127022716 CCTGTGCCTGCTGGACAGCTGGA 0: 1
1: 0
2: 0
3: 27
4: 333
Right 961455664 3:127022730-127022752 GCCCATATTCTGTGCTCCCCAGG 0: 1
1: 0
2: 1
3: 10
4: 131
961455661_961455668 26 Left 961455661 3:127022694-127022716 CCTGTGCCTGCTGGACAGCTGGA 0: 1
1: 0
2: 0
3: 27
4: 333
Right 961455668 3:127022743-127022765 GCTCCCCAGGACTGAGTCGGTGG 0: 1
1: 0
2: 1
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961455661 Original CRISPR TCCAGCTGTCCAGCAGGCAC AGG (reversed) Intronic
900120923 1:1048323-1048345 TGCAGCTGCCCGGCAGGCAGGGG + Exonic
900134559 1:1110015-1110037 TCTAGCAGTTAAGCAGGCACTGG - Intronic
901242226 1:7702180-7702202 TGCAGCAGCCCAGGAGGCACTGG - Intronic
902282315 1:15383558-15383580 TCCTGCAGTCCACAAGGCACTGG + Intronic
902327423 1:15710820-15710842 TCCAGCTACCCAGCAGGCTGAGG + Intronic
903772209 1:25771060-25771082 GCCCACTGTCCAGCAGGCAGAGG + Intronic
904573304 1:31484196-31484218 CCCAACAGTCCAGCAGGCAGAGG + Intergenic
906341575 1:44985646-44985668 TCCAGCTCTCAAGGAGGCCCTGG + Intronic
907089194 1:51709045-51709067 TCCTGCTGGCCAGCGGGCAGCGG - Intronic
907091892 1:51732817-51732839 TCCAGCTGCCCAGCATGTCCTGG + Intronic
907444437 1:54498971-54498993 TCCAGCTGCCCTGCAGGACCTGG + Intergenic
909994925 1:82267640-82267662 TCCAGCTGTCCCACAGTCCCGGG + Intergenic
910963435 1:92785049-92785071 ACCAGCTGGCCAGCTGGCAAGGG - Intronic
911725202 1:101235970-101235992 TGCAGCTGCCCAGCAGGAGCCGG - Intergenic
913182833 1:116338980-116339002 TCCAGCTATCCAGGAGGCTGAGG - Intergenic
913665534 1:121044983-121045005 TCCAGCTGTTCAGGAGGCTGAGG - Intergenic
914016932 1:143828253-143828275 TCCAGCTGTTCAGGAGGCTGAGG - Intergenic
914160853 1:145132745-145132767 TCCAGCTGTTCAGGAGGCTGAGG + Intergenic
914655541 1:149736795-149736817 TCCAGCTGTTCAGGAGGCTGAGG - Intergenic
914704805 1:150161874-150161896 TCCAGTTCTCCAGCAGTTACTGG + Intronic
915319377 1:155047817-155047839 TGCAGCTCTCCAGTAGGCCCTGG - Exonic
917138495 1:171810914-171810936 CCCAGCTATCCAGCAGGCTGAGG - Intronic
917164994 1:172101972-172101994 TCCAGCTGCCCAGGAGGCTGAGG - Intronic
917670904 1:177272567-177272589 CCCTGCTTTGCAGCAGGCACAGG - Intronic
918464017 1:184803602-184803624 TCCCACTGTGCAGAAGGCACTGG - Exonic
920251337 1:204624364-204624386 CACAGCTGGCCAGCAGTCACTGG - Intronic
920309737 1:205042034-205042056 GCCTGCTGTCCAGCTTGCACAGG - Intergenic
920310094 1:205043674-205043696 TCCAGTTGGCCAGCGGGCAGTGG + Intronic
921048457 1:211493678-211493700 TCCAGCAATCCAGCACACACAGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1062761762 10:28005-28027 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1065970869 10:30805166-30805188 CTCAGCTGTCCAGCAGATACCGG - Intergenic
1066330701 10:34418884-34418906 TCCAGCTATTCAGGAGGCAGAGG - Intronic
1067059704 10:43071954-43071976 GTCAGCTGTCCAGCAGATACAGG - Intergenic
1067062410 10:43084479-43084501 TGCAACTGGCCAGCATGCACAGG - Intronic
1067174253 10:43931292-43931314 TCCCCCTTTCCAGAAGGCACTGG - Intergenic
1067694927 10:48527883-48527905 TCCAGCCCACCACCAGGCACAGG + Intronic
1067764088 10:49072221-49072243 ACCAGCTCTACAGCAGGCACAGG - Intronic
1068373990 10:56155153-56155175 TCCAGCTGGCCAGCAAGCGCCGG - Intergenic
1069502090 10:68963009-68963031 CCCAGCTGTCCATCAGGCTGAGG + Intronic
1069719216 10:70539224-70539246 TCCAGCTGGTCAGGAGCCACAGG - Exonic
1073442320 10:103559430-103559452 CCCTGCCGTCCAGCAGGCAAGGG - Intronic
1075409077 10:122214148-122214170 TCCAGGTGGCCAGCAGTCCCAGG + Intronic
1075979189 10:126722435-126722457 TTCAGCTGTCCTGCAGGACCTGG + Intergenic
1076033384 10:127177993-127178015 CCCAGCTGTCCAACAGACAGAGG + Intronic
1076433299 10:130422567-130422589 GCCACTTCTCCAGCAGGCACAGG + Intergenic
1076506033 10:130973266-130973288 TCCAGCTGTGCAGCAGGGCCTGG - Intergenic
1076549606 10:131269892-131269914 TTCACCTGCCCAGTAGGCACAGG - Intronic
1076739495 10:132476346-132476368 CCCAGCTCTCCATCAGGCTCGGG - Intergenic
1076840540 10:133043199-133043221 TCCAGCTCTGCGGCAGGCAGGGG + Intergenic
1077173242 11:1177658-1177680 TCCAGGTTTCCAGCCGGCCCTGG - Intronic
1077211041 11:1371061-1371083 TCCAGCTGTCAAGCAAGGCCAGG - Intergenic
1079592065 11:22193128-22193150 ATCAGCTGCCGAGCAGGCACAGG + Intergenic
1079930852 11:26558385-26558407 TTCAGCTGTTCAGCAGCCTCAGG + Intronic
1080825994 11:35849883-35849905 TCCAGCTATCCAGGAGGCTGAGG + Intergenic
1081974525 11:47223983-47224005 TCCAGCTGTTCAGGAGGCTGAGG + Intronic
1084700132 11:70781295-70781317 GCCAGCTGCCCAACAGGCACTGG + Intronic
1085160584 11:74340072-74340094 TCCTTCTGTGCTGCAGGCACAGG - Intronic
1085245571 11:75098237-75098259 TCCAGCTGGCCTGCAAGCGCAGG - Intergenic
1087322753 11:96683454-96683476 ACCAGCAGTCTAGCAGCCACTGG + Intergenic
1088868014 11:113867610-113867632 TCCAGCTCTGCAGCAGGCTGAGG + Intronic
1088908401 11:114171915-114171937 TCCTGCTCTTCAGCAGGCAGAGG - Intronic
1088976125 11:114817921-114817943 TCCTGCTGTCCTGCATGAACAGG + Intergenic
1089603475 11:119628588-119628610 TTCAACTGTCCAGCTGGCCCGGG + Intronic
1090972070 11:131652699-131652721 TCCCGCTGCCCAACAGGCAGGGG - Intronic
1091520479 12:1235241-1235263 TCCAGCTGTTCAGGAGGCTGAGG + Intronic
1091639178 12:2221464-2221486 CCCAACTGCCCAGCAGGCCCTGG - Intronic
1092033027 12:5305655-5305677 AGCAGCTCTCCAGCAAGCACCGG + Intergenic
1092287432 12:7136871-7136893 TCCTGCTGTCCAGTTGGCATTGG - Exonic
1092822544 12:12366037-12366059 TGCAGCAGCCCAGCAGGCAGAGG - Intronic
1093152748 12:15642798-15642820 TACAACTGTCCTGCAGGCCCTGG - Intronic
1093381535 12:18500177-18500199 TCCAGCCGGCCGGCAAGCACTGG - Intronic
1094811510 12:34142946-34142968 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1096307168 12:50487904-50487926 TCCAGCTGTTCAGGAGGCTGAGG + Intergenic
1096728515 12:53585660-53585682 TCCAGCTTCCAAGCAGGAACTGG + Intronic
1097018668 12:56004875-56004897 TCCTTTTGTCCAGCTGGCACAGG - Exonic
1097526456 12:60742116-60742138 CCCAGCTGTCCAGGAGGCTGAGG - Intergenic
1097661470 12:62435643-62435665 TGCAGCTGTCCAGTGGACACTGG - Intergenic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1098526915 12:71497197-71497219 TCCAGCTATCCGGCAGGCTGAGG + Intronic
1099380896 12:81951047-81951069 TCCACATGACCAGCAAGCACCGG - Intergenic
1100464600 12:94834150-94834172 TCCAGTCCCCCAGCAGGCACAGG + Intergenic
1100886224 12:99073540-99073562 GTGAGCTGTCCAGCAGCCACCGG - Intronic
1101214555 12:102567358-102567380 GCCAGCTATGCACCAGGCACTGG - Intergenic
1101995835 12:109524317-109524339 TCAAGCTGTTCAGCAGCCATGGG + Intronic
1102248057 12:111367673-111367695 TCAAGGTCACCAGCAGGCACAGG + Intronic
1103443963 12:120981869-120981891 TCCTGCTGTGCATCAGCCACTGG - Intronic
1103510132 12:121467890-121467912 GCCAGCGGTCCTGCAGGCTCTGG - Intronic
1103749828 12:123151024-123151046 TAGAGCTGTCCAGCCGGCCCCGG - Intergenic
1106561563 13:30851186-30851208 TCCTGCTGTCCAGATAGCACTGG + Intergenic
1106673477 13:31932394-31932416 TCCAGCTGCCCAGGAGGCTGAGG - Intergenic
1108211135 13:48141091-48141113 TCCCGTTTTCCAGAAGGCACAGG + Intergenic
1111507730 13:89215981-89216003 CCCAGCTGTCCAGGAGGCTGAGG + Intergenic
1111507741 13:89216026-89216048 CCCAGCTGTCCAGGAGGCTGAGG + Intergenic
1112693278 13:101918476-101918498 TCCAGCTCTAAAGCAGTCACTGG - Intronic
1114054377 14:18953761-18953783 TCCAGCTATTCAGGAGGCAGAGG + Intergenic
1114108176 14:19448172-19448194 TCCAGCTATTCAGGAGGCAGAGG - Intergenic
1114321952 14:21554318-21554340 TCCAGCTGTTCAGGAGGCTGAGG + Intergenic
1114452977 14:22838464-22838486 TCCAGCTCTGCAGTAGGCCCTGG - Intronic
1115806214 14:37054985-37055007 TCCAGCTGGGCAGAAGTCACTGG - Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1118201632 14:63679573-63679595 TCCAGCTGTTCAGGAGGCTGAGG + Intergenic
1118313552 14:64709829-64709851 TCCTACTGTACAACAGGCACTGG - Intronic
1118985246 14:70748876-70748898 TCCAGTTGTCCTGCAGGCAGTGG + Exonic
1119261671 14:73241387-73241409 TGCAGCTGTCCAGGTGGCTCTGG - Intronic
1119395978 14:74326707-74326729 TCCAGCTGTCTAGCACTCCCTGG - Intronic
1120027197 14:79599877-79599899 CCCAGCTGTCCAGAAGGCTGAGG + Intronic
1120585080 14:86302569-86302591 CCCAGCAGTCCAACATGCACTGG + Intergenic
1121518888 14:94572104-94572126 TCCAACTTCCCAGAAGGCACAGG - Intronic
1121941105 14:98071831-98071853 TCCATCTTTCAAGAAGGCACAGG + Intergenic
1122262255 14:100530341-100530363 TCCAGAGGTCCAGCAGGCCTGGG - Intergenic
1122268246 14:100556698-100556720 TCCAGTCCTGCAGCAGGCACTGG - Intronic
1122328471 14:100897010-100897032 CCAAGCTGTCCAGCACCCACGGG - Intergenic
1124461341 15:29894969-29894991 CCCAGTTGTGCAGCAAGCACAGG + Intronic
1126027781 15:44464819-44464841 TCCAGCTATCCAGGAGGCTGAGG - Intronic
1126535401 15:49756723-49756745 GCCAGCAGTCCAGCAGCCACTGG + Intergenic
1127867587 15:63044244-63044266 TGCAGGTGTCCAGCAGGAAAAGG - Intronic
1130878126 15:88032003-88032025 TCCAGCTCTCAGGCAGGCATGGG + Intronic
1131156753 15:90080412-90080434 CCCAGCTGTCCTGCAGGCCAGGG - Exonic
1131165874 15:90141907-90141929 TCCAGCTGTCCATCCTCCACGGG - Intergenic
1132148967 15:99446520-99446542 TCCAGCAAACCAGCAGACACTGG + Intergenic
1132238880 15:100242251-100242273 TCCAGCGGCCGAGCAGTCACTGG + Intronic
1132600148 16:769553-769575 TCCCCCAGTGCAGCAGGCACAGG + Exonic
1132797993 16:1734666-1734688 AGCAGGTGTCCAGCAGGGACGGG - Intronic
1133160999 16:3911629-3911651 TCCAGCTATCCAGGAGGCTGAGG + Intergenic
1134092052 16:11396690-11396712 TCTAGGTGTCAGGCAGGCACAGG + Intronic
1134478147 16:14593879-14593901 TCCAGCTACCCAGCAGGCTGAGG + Intronic
1136374266 16:29856065-29856087 CCCAGCTGTTCAGCAGGCTGAGG + Intergenic
1137276676 16:46939169-46939191 AGCAGCTGTGCACCAGGCACAGG + Intergenic
1137574536 16:49590288-49590310 TCCAGCTGTGCAGCATGCCCGGG - Intronic
1138065526 16:53937354-53937376 ACAAGCTGTCCATCAGGCAGAGG - Intronic
1138614792 16:58156859-58156881 TCCTGCTGTCCTACAGGCAGTGG + Intergenic
1139267344 16:65652364-65652386 TCCAGAGAGCCAGCAGGCACGGG + Intergenic
1139872385 16:70117975-70117997 TCCAGCTGTTCAGGAGGCCGAGG + Intronic
1140736345 16:77901277-77901299 TCCAGCTATCCAGGAGGCTGAGG - Intronic
1141310433 16:82908469-82908491 GCCACCTGCCCAGCAGGCATGGG + Intronic
1141980437 16:87546976-87546998 TCTAGCTTTCCAGCAGGCAGGGG + Intergenic
1142362563 16:89634437-89634459 TCCAGCTGCCCAACAGGGCCTGG - Intronic
1142538028 17:633759-633781 TAGAGCTGTCCAGCAGACAATGG + Intronic
1143617215 17:8059460-8059482 TCCAACTGTCCATCAGGTAAAGG - Intergenic
1144342631 17:14322786-14322808 AGCAGCTGTCCACCAGCCACGGG - Intronic
1144848880 17:18234109-18234131 TCCAGATGACCAGCAGGCCCCGG - Exonic
1144863820 17:18322499-18322521 TCCACCTAGCCAGCATGCACTGG - Intronic
1145882276 17:28360977-28360999 TAGAGCTTTCCAGCAGTCACGGG + Intronic
1147993945 17:44351279-44351301 TCCAGCTGTGGAGCCGGCAAAGG + Intronic
1148856280 17:50580805-50580827 GACAGCTGTCCAGCGGGCTCAGG + Intronic
1150644711 17:66970814-66970836 ACCAGCTGTGAAGCAGACACAGG - Intronic
1152599054 17:81252360-81252382 GCCAGCTGTCCAGCCTGCAAAGG - Exonic
1152954669 18:28335-28357 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
1153042614 18:828103-828125 TCCAGCTGTTCAGGAGGCTGAGG - Intergenic
1153566275 18:6421046-6421068 TCCAGCTACTCAGCAGGCTCAGG - Intergenic
1153977820 18:10284935-10284957 CCCAGCTGTCCCTCAGGCACAGG - Intergenic
1156499760 18:37550249-37550271 TCCAGCTAATCAGCAGACACAGG - Intronic
1158212862 18:55069911-55069933 TCATGCTGTCCAGCTGGGACAGG + Intergenic
1158597873 18:58832260-58832282 TCCATCTGCCCAGCAGGAAAGGG + Intergenic
1159586192 18:70285982-70286004 TCCAGCTGTTCAGGAGGCTGAGG - Intergenic
1159593209 18:70357121-70357143 TCCTGCTGTATACCAGGCACTGG - Intergenic
1160214008 18:76910700-76910722 TCCACCTGTCCAACAGCTACAGG + Exonic
1161044380 19:2127262-2127284 TCCAGCTGAGCTGCCGGCACTGG - Intronic
1161407052 19:4096473-4096495 TGCAGCTGTCAGGGAGGCACAGG - Intronic
1162153025 19:8658832-8658854 TCCAGCTGTTCAGGAGGCTGAGG + Intergenic
1162605030 19:11700070-11700092 TTCAGCAGTCCAGCTGGCCCAGG + Intergenic
1162903494 19:13809235-13809257 TCCCGGTGTCCACCACGCACCGG - Intronic
1163061350 19:14764432-14764454 TTCAGTTATCCTGCAGGCACAGG - Exonic
1163991890 19:21006588-21006610 TCCTCCTGTCCACCAGGCATGGG + Intergenic
1164452656 19:28380330-28380352 TCCAGCTCTCCAGCAGCCTCAGG + Intergenic
1164586928 19:29481618-29481640 TCTAGCTGACCTGCAGGAACAGG - Intergenic
1166354845 19:42220852-42220874 GCAAGCTTTGCAGCAGGCACTGG + Intronic
1167479249 19:49719470-49719492 TCCAGCAGCCCAGGAGGGACAGG + Intergenic
1168113388 19:54207581-54207603 TCCAGCAGCCCAGGAGGGACAGG - Exonic
1168269825 19:55243547-55243569 TCCAGCTGTTCATGAGGCAGAGG + Intronic
926119921 2:10236278-10236300 CCCAGCTGCCCAGAGGGCACAGG + Intergenic
928467520 2:31536397-31536419 TGCATCTATCCAGCAGGCAAAGG + Intronic
928850014 2:35734396-35734418 TCCAGCTGGCCAGCAGCAGCAGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929097756 2:38280158-38280180 TGAAGCTATCAAGCAGGCACTGG - Intergenic
930009378 2:46924086-46924108 TCCAGCTACCCAGGAGGCAGAGG + Intronic
930296632 2:49562594-49562616 TGCAGCTGTCCAGCAGAGCCAGG - Intergenic
932003721 2:67907291-67907313 TGCAGCTCTCAAGAAGGCACTGG - Intergenic
932549920 2:72758045-72758067 TCCAGCTGTTCAGGAGGCTGAGG + Intronic
932744141 2:74317713-74317735 TCTAGGAGTCCAGCAGGCAAAGG - Intronic
933458939 2:82554286-82554308 TCCAGCTGTCCACTTAGCACTGG + Intergenic
934764012 2:96870266-96870288 TCCGGGTGTCCAGCAGCCCCGGG + Intronic
934938879 2:98485190-98485212 TTCAGCTCTTCAGCAGCCACGGG - Intronic
937025072 2:118690963-118690985 TCTAGCTGTCCTTCAGGCAGAGG + Intergenic
937912011 2:127080338-127080360 TCCAGGTGTCCAGGAGGGGCTGG + Intronic
938470389 2:131554334-131554356 TCCAGCTATTCAGGAGGCAGAGG + Intergenic
938472391 2:131576524-131576546 TCCAGCTATTCAGGAGGCAGAGG + Intergenic
939780994 2:146447341-146447363 TACAGTTGTCCAGCAAGCATAGG - Intergenic
941809982 2:169745884-169745906 AAGAGCTGTCCAGCAGGCAAAGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942960688 2:181827239-181827261 TCCAGCTGTTCAGGAGGCTGAGG - Intergenic
945084458 2:206117076-206117098 TCCAGCTGTTCAGGAGGCTGAGG + Intronic
945649016 2:212537528-212537550 TCGAGCTCTCCAGCAAGCAGTGG + Intronic
946431654 2:219629680-219629702 CCCAGCACTCCAGCAGGTACTGG + Exonic
947098357 2:226592076-226592098 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
948059029 2:235030229-235030251 TCCAGGGGCCCAGCAGCCACTGG + Intronic
948150418 2:235740145-235740167 TCCCGCTGCCCAGCAGGAGCAGG + Intronic
948175858 2:235942250-235942272 TCCAGGAGTCCAGTAGCCACGGG + Intronic
948717140 2:239872161-239872183 TCCAACTGTCCTGCAGGAAAGGG + Intergenic
948768416 2:240235105-240235127 TGCAGCTGGCCAGGACGCACAGG - Intergenic
948799764 2:240427196-240427218 TCCAGCTGTGTAGCAGGAACTGG + Intergenic
949017555 2:241722001-241722023 CCCAGCTGTCCACCTGGCACAGG - Intronic
1169091794 20:2865383-2865405 CCCAGCTTTCCTGCAGGCTCTGG + Exonic
1170420823 20:16191299-16191321 TCCAGGTTTCTAGCAAGCACTGG + Intergenic
1171431826 20:25087765-25087787 TCCAGCTGTCCATCAGTCTGGGG + Intergenic
1172649692 20:36493915-36493937 TTCAGCTGGCCACAAGGCACAGG - Intronic
1173065355 20:39705387-39705409 TCCAGCTGCCAAACAGGCAGTGG - Intergenic
1174776190 20:53345320-53345342 TCCAGGTGTCTAACAGGCAATGG - Intronic
1175897538 20:62346026-62346048 TCCCGGAGTCCAGCAGGCAGTGG + Intronic
1179738683 21:43404294-43404316 GCCAGCTGTCCAGAGGGCATAGG - Intergenic
1180150664 21:45945590-45945612 TCCAGCTCCCCTGCTGGCACTGG + Intergenic
1180472849 22:15676136-15676158 TCCAGCTATTCAGGAGGCAGAGG + Intergenic
1180878001 22:19184177-19184199 TCTAGCTCCACAGCAGGCACTGG + Intronic
1181300566 22:21877865-21877887 TCCAGCTATCCAGGAGGCTGAGG + Intergenic
1181465556 22:23108816-23108838 ACCACCTCTCCAGCAGGCAGAGG - Intronic
1181713593 22:24707316-24707338 TCCTGCTGGCCACCAGGCAGGGG - Intergenic
1183732583 22:39627135-39627157 TCCTGATGTCCTGCAGACACTGG - Intronic
1183789325 22:40052570-40052592 TCCAGCTGTTCAGGAGGCTGAGG - Intronic
1183995356 22:41629006-41629028 TGCAGATGTCCAACAAGCACAGG + Intronic
1184343059 22:43896597-43896619 TCCAGGAGTCCAGGAGGCAGAGG - Intergenic
1184583792 22:45434334-45434356 TCTAGCAGCCCAGCAGGCTCAGG + Intergenic
1185222954 22:49638116-49638138 GGCAGCTGCCCAGCAGGCAGCGG - Intronic
949185579 3:1187798-1187820 TCCATGTGCCCAGGAGGCACTGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950376991 3:12580272-12580294 TGGAGTTGTCCAGCAGGCTCTGG + Intronic
950476637 3:13219187-13219209 TCCACCTCACCAGCAGGCCCTGG + Intergenic
951059381 3:18187539-18187561 TCCAGTTGTCCTGAAGTCACAGG - Intronic
951791161 3:26486305-26486327 TCCAGCTATTCAGGAGGCAGAGG - Intergenic
952925261 3:38315452-38315474 CCCAGCTGGCCAGCAGGCTCAGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953431695 3:42845475-42845497 TCCAGCTGTTCAGGAGGCTGAGG - Intronic
954426373 3:50445341-50445363 TGCAGCTGACCACAAGGCACCGG + Intronic
955919403 3:63939789-63939811 GCCAGCAGTCTAGCAGCCACTGG + Intronic
956386514 3:68725265-68725287 TCCAGCTGGCCAGCAGTGGCAGG - Intergenic
957921910 3:86758061-86758083 TCCACCTCTCCACCAGGCTCAGG - Intergenic
958587851 3:96114493-96114515 ACCAGCAGCCCAGCAGACACTGG - Intergenic
959696455 3:109253882-109253904 TCCAAATGTTCAGAAGGCACAGG + Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961455661 3:127022694-127022716 TCCAGCTGTCCAGCAGGCACAGG - Intronic
961585820 3:127922615-127922637 TACAGCTGACCTGCAGGCAGAGG - Intronic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
964056860 3:152471861-152471883 CCCAGCTATCCAGCAGGCTGAGG - Intergenic
966837355 3:184059431-184059453 TCCAGGTGGCCATCAGGCGCAGG + Exonic
967619551 3:191616432-191616454 TCCAGCAGCCAAGCAGCCACTGG + Intergenic
968135420 3:196216678-196216700 TCCAGCAATCCCGCAGGCACCGG - Exonic
968347884 3:198026431-198026453 TCCAGCTGTGCAGGAGGCTGAGG - Intronic
968459690 4:718329-718351 TGCAGCTGTCCAGGAGGCCCAGG - Intronic
968657876 4:1786456-1786478 TCCAGCTCAGCCGCAGGCACTGG - Intergenic
969387450 4:6864157-6864179 TCCAGCTGTCCCGAAGAAACTGG - Exonic
971692588 4:29856637-29856659 ACAAACTGTACAGCAGGCACTGG + Intergenic
972361512 4:38329820-38329842 TCCAGCTATAAAGCAGACACTGG - Intergenic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
977588932 4:98805394-98805416 TCCAGCTATCCAGGAGGCTGAGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
985580862 5:694435-694457 ACCAGGTGTCCAGCAGGCCCTGG + Intergenic
985595487 5:785767-785789 CCCAGGTGTCCAGCAGGCCCTGG + Intergenic
985610135 5:883142-883164 TGCAACTTCCCAGCAGGCACAGG + Intronic
985653200 5:1116399-1116421 TACCCCTGCCCAGCAGGCACAGG - Intergenic
985708240 5:1413963-1413985 TCCAGGTCTCGGGCAGGCACAGG - Intronic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987290686 5:16505629-16505651 TCCAGCTGTCCTGAAGGGAGAGG - Intronic
990230967 5:53712578-53712600 TCCAGCTGGCCAGCAGCAGCAGG - Intergenic
992264609 5:75005983-75006005 TACAGCTGTGCAGCAAGCCCAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
997592849 5:135086298-135086320 TCCTGCTGTCAACCAGGCATGGG + Intronic
997892629 5:137688463-137688485 TCCAGCTGTCCGCTAGACACAGG - Intronic
998752742 5:145340649-145340671 TCCAGCTACCCAGGAGGCACAGG + Intergenic
999180687 5:149668314-149668336 GCCTGCTGCCCAGCAGGTACAGG - Intergenic
999326589 5:150648055-150648077 TCCAGCTCTTCAACAGGCGCCGG + Exonic
999624174 5:153502643-153502665 GCCTGCTGTCCAGAAAGCACAGG + Intronic
1000047830 5:157536057-157536079 TCCAACTTTGCTGCAGGCACCGG + Intronic
1002120907 5:177003942-177003964 CCCAGCTGCCCAGGAGGCTCTGG - Intronic
1004276084 6:14236236-14236258 AGCAGCTGTCCAGGAGGGACAGG + Intergenic
1004870186 6:19896502-19896524 TCCAGCTGTCCACCCAGCAAAGG + Intergenic
1005267371 6:24126208-24126230 CCCAGCTGTCAATCAGGCGCGGG + Exonic
1006026435 6:31150149-31150171 GCCAGCGGTTCAGCAGGGACTGG + Exonic
1006255636 6:32830085-32830107 ACCACCTGTGCAGCAGGGACAGG + Exonic
1006931673 6:37692528-37692550 CCCAGCTGCCCAGGAGGCATGGG - Intronic
1008270519 6:49483745-49483767 TACAGCTGACCTGCAAGCACCGG + Intronic
1008366219 6:50683375-50683397 TCCAGCTGCCCAGGAGGCTGAGG + Intergenic
1008991210 6:57604199-57604221 TCCAGCTATTCAGGAGGCAGAGG + Intronic
1010445540 6:75944882-75944904 CCAGGTTGTCCAGCAGGCACTGG + Intronic
1013351907 6:109313400-109313422 TCCTGCTGTCCTGCAGCCAGCGG - Intergenic
1016990157 6:149922939-149922961 TCCTGCTGTCCAGCTGGTGCAGG - Exonic
1017237253 6:152129708-152129730 TCCAGCTGTACATAAGGGACTGG - Intronic
1017467400 6:154707248-154707270 TCCAGCTACTCAGAAGGCACAGG + Intergenic
1017990841 6:159488667-159488689 CCCAGATGTCCAGCTGACACTGG - Intergenic
1019621167 7:1992768-1992790 TCCACCTGTCCTGGAGACACTGG - Intronic
1019900763 7:4019115-4019137 TCCCACTGTACAGGAGGCACTGG - Intronic
1020000339 7:4752066-4752088 TCCAGCTGTTCAGGAGGCTGAGG - Intronic
1020999908 7:15316023-15316045 TCAAGCAGAACAGCAGGCACTGG + Intronic
1021450932 7:20783882-20783904 GCCCGCTGTCTACCAGGCACTGG + Intronic
1023134834 7:37040962-37040984 TCCAGCTGCTCAGGAGGCAGAGG + Intronic
1023866934 7:44242786-44242808 CCCACCTGTGCAGCAGACACTGG + Intronic
1023903082 7:44499306-44499328 ACCAGCTATCCAGGAGGCAGAGG + Intergenic
1025040398 7:55638409-55638431 ACCAGCTTTTCAGCAGGCTCTGG + Intergenic
1025066668 7:55862699-55862721 TTCAGCTGTGCAGCAGACACAGG + Exonic
1025280868 7:57625860-57625882 CCCAGGTGTACAGCAGGCTCAGG + Intergenic
1025303862 7:57839647-57839669 CCCAGGTGTACAGCAGGCTCAGG - Intergenic
1026114981 7:67488514-67488536 TCCAGCTGCTCAGGAGGCCCAGG - Intergenic
1029128107 7:98309268-98309290 TCCAGCTGTTCAGGAGGCTGAGG - Intronic
1029458853 7:100684230-100684252 TCCAGCTGGTCAGCAGGTATGGG - Exonic
1029608688 7:101615107-101615129 GGCAGCTGTCTGGCAGGCACCGG - Intronic
1033873634 7:145787536-145787558 CCCAGCTGTTCAGTAGGCAGAGG - Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1034879861 7:154755305-154755327 CCCAGCAGCCCAGCATGCACAGG + Intronic
1035373397 7:158393039-158393061 TCCTTCTCTGCAGCAGGCACAGG - Intronic
1035648890 8:1249158-1249180 TCCAGCAGTAAAGCAGGCAAGGG - Intergenic
1036009132 8:4701414-4701436 TCCAGCTGTGGTTCAGGCACAGG - Intronic
1036241497 8:7085398-7085420 TACAGCTGGCAAGAAGGCACAGG + Intergenic
1036709158 8:11067311-11067333 TCCAGGTGTCCGGGAGGCAAGGG - Intronic
1036824733 8:11967207-11967229 ACCAGGTGTCCTGCAGGCACAGG + Intergenic
1037765415 8:21769471-21769493 TCCAGCTGCCCTGCAAGCACTGG - Intronic
1037890091 8:22619444-22619466 ACCAGAGGGCCAGCAGGCACCGG + Intronic
1038228970 8:25683267-25683289 TCCAGCTGCCCAGGAGGCTGAGG - Intergenic
1038423482 8:27449664-27449686 TCCATCTGTCCAGGAGGCCAGGG + Intronic
1038742628 8:30228870-30228892 TCCAGCTGTTCAGGAGGCTGAGG - Intergenic
1039505640 8:38050463-38050485 TCCAGCTACCCAGGAGGCAGAGG - Intronic
1039604999 8:38873060-38873082 TCCAGCTGCCCAGGAGGCTGAGG + Intergenic
1040361740 8:46671599-46671621 TTCAGCTGTGCAGCAGACACAGG - Intergenic
1041525326 8:58799227-58799249 TCCAGCTGTCCAGAAGTCGAAGG + Intergenic
1044302357 8:90599884-90599906 TCCAGCTGTTCAGGAGGCTGAGG - Intergenic
1045065107 8:98437418-98437440 TCCATCTGCCCAGCAGTCCCTGG + Intronic
1045757433 8:105561350-105561372 TCCAGCTCTCCTGCAGACAAAGG - Exonic
1046288872 8:112132724-112132746 TCCAGCTGGCCTGCAAGCGCCGG - Intergenic
1047153025 8:122285757-122285779 TCCAGCTGTTCAGGAGGCTGAGG - Intergenic
1049389260 8:142359672-142359694 TGCACCTGCTCAGCAGGCACTGG + Intronic
1049597577 8:143491824-143491846 TCCCTCAGTCCTGCAGGCACAGG + Intronic
1051122041 9:13761925-13761947 TCCAGCAGACCAGCAGCTACTGG + Intergenic
1052231026 9:26153206-26153228 TACAGCTGTGCAGAAGGCCCAGG + Intergenic
1053561308 9:39198254-39198276 AACAGCTCTTCAGCAGGCACTGG - Intronic
1053825404 9:42018492-42018514 AACAGCTCTTCAGCAGGCACTGG - Intronic
1054135811 9:61420693-61420715 AACAGCTCTTCAGCAGGCACTGG + Intergenic
1054605159 9:67168865-67168887 AACAGCTCTTCAGCAGGCACTGG + Intergenic
1055957730 9:81790361-81790383 TCAAGAAGTCCAGCTGGCACAGG + Intergenic
1056297767 9:85209638-85209660 TCCAGCTGCTCAGCAGGCTGAGG + Intergenic
1057439172 9:95070134-95070156 TCCACCTGTCCAGAAGCCCCTGG + Intronic
1057828098 9:98386594-98386616 TCCAGCTGCCCAGCAAGCCAGGG + Intronic
1057891350 9:98872301-98872323 CGCAGCTGGCCAGCAGACACTGG - Intergenic
1058457249 9:105148902-105148924 TCCAGCTGTCCAGCAGCTTCAGG - Intergenic
1060630619 9:125155021-125155043 TCCAGCTGTTCAGAAGGCTGAGG - Intronic
1062273480 9:135720215-135720237 TCCAGCTGCCCCGCAGGGACAGG + Intronic
1062474918 9:136722120-136722142 TCCAGGTGTACAGCGGGCTCTGG + Exonic
1185662858 X:1740983-1741005 TCCAGCTGATCAGCAGGCTGAGG - Intergenic
1186163963 X:6806993-6807015 TCCACCTGTCCAGTAGGTAGTGG - Intergenic
1186890245 X:13952687-13952709 TTCAGCTGTTCAGCTGGGACAGG + Intergenic
1187700135 X:21957104-21957126 ACAAGCTGCCCACCAGGCACGGG - Intronic
1187919450 X:24186505-24186527 TCCAGCTGCTCAGGAGGCAGAGG + Intronic
1187962732 X:24582086-24582108 CCCAGCTGTGCAGGAGGCTCTGG + Intronic
1190738294 X:53270077-53270099 TAGAGCTGTCCAGCAAGCATTGG - Intronic
1191087956 X:56588802-56588824 TCAAGTTGTCAAGCAGGCCCTGG + Intergenic
1192366338 X:70476875-70476897 TCCAGCTGCCCATCAGTCTCTGG - Intronic
1192769290 X:74170143-74170165 TCAAGCTGTCAAGTAGCCACTGG - Intergenic
1198051984 X:132958985-132959007 TCAAGCCCTCCTGCAGGCACAGG - Intronic
1199699319 X:150364319-150364341 TCCAGCTTTCCAGGAGGCTTCGG - Intronic
1200039077 X:153353079-153353101 TCCAAGTGCCCAGCAAGCACTGG - Intronic
1201177876 Y:11321176-11321198 TCCAGGAATCCAGCAGGAACTGG - Intergenic
1201179436 Y:11331951-11331973 TCCAGGAATCCAGCAGGAACTGG - Intergenic