ID: 961456466

View in Genome Browser
Species Human (GRCh38)
Location 3:127027102-127027124
Sequence ACGTGTGCTGGGCGCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961456454_961456466 30 Left 961456454 3:127027049-127027071 CCTTCAGAGAACGACAGATGGCG 0: 1
1: 0
2: 0
3: 1
4: 56
Right 961456466 3:127027102-127027124 ACGTGTGCTGGGCGCTCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961456466 Original CRISPR ACGTGTGCTGGGCGCTCCCC AGG Intronic
900120863 1:1048162-1048184 ACGTGTGGTGGGGGCTGCCGTGG - Exonic
900184566 1:1327053-1327075 TCCTGAGGTGGGCGCTCCCCTGG + Intronic
900218593 1:1495326-1495348 ACGCGTGCTGGGCTCTGCCAAGG + Intronic
900484624 1:2915885-2915907 ACGTGTGCTGTGCGCTGTGCAGG - Intergenic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901051776 1:6429027-6429049 GAGTGGGCTGGGAGCTCCCCTGG + Intronic
903153648 1:21430048-21430070 GGGTGAGCTGGGGGCTCCCCAGG - Intergenic
903221918 1:21873949-21873971 ACCTGTGATGCGTGCTCCCCAGG - Exonic
904325385 1:29724508-29724530 ATGTGAGCTGGGAGCTCCCTGGG - Intergenic
904433651 1:30480363-30480385 ATGTGTGCTGGGAGCTCCCTGGG + Intergenic
905124654 1:35708174-35708196 GCTGGTGCTCGGCGCTCCCCGGG - Intergenic
919804884 1:201375656-201375678 ACTAGTTCTGGCCGCTCCCCTGG - Intronic
924908798 1:248486366-248486388 ACATGTGCTGGTCGCTCCTCTGG + Intergenic
924915309 1:248561696-248561718 ACATGTGCTGGTCGCTCCTCTGG - Intergenic
1062791307 10:308051-308073 CCGTGTGCTGGGCCCCGCCCAGG - Intronic
1062921211 10:1281264-1281286 GCATGTGCTGGGGGGTCCCCAGG + Intronic
1063115567 10:3069095-3069117 CCGTGCGCCGCGCGCTCCCCAGG + Intronic
1063196758 10:3750472-3750494 ATGTGTGCTGAGCGCTTCCTGGG + Intergenic
1067748926 10:48957369-48957391 ACCTTTGCTAGGCCCTCCCCAGG + Intronic
1069918097 10:71799375-71799397 TCGTGGGCTGGGCACTCCCAGGG - Intronic
1072454356 10:95562842-95562864 CCGTGGGCTGGGGGCTCCCTAGG - Intergenic
1072724969 10:97807056-97807078 CCGTGTGCTGGGCACTGTCCTGG + Intergenic
1072797427 10:98366579-98366601 ATATGTGCTGGGTGCTACCCTGG + Intergenic
1073434880 10:103510416-103510438 ACGTGTGCTGAGCGGCCCCTGGG + Intronic
1077342132 11:2030881-2030903 AGGTGGGCAGGGGGCTCCCCAGG + Intergenic
1077344604 11:2040402-2040424 CCTTGTGCTGGGGGCTCTCCTGG + Intergenic
1078527021 11:12109283-12109305 ACGTGTGAAGGGCACTCCCCAGG + Intronic
1083291856 11:61694979-61695001 ACAGGTGCTTGGTGCTCCCCAGG - Intronic
1083879394 11:65540666-65540688 GCGTGGGCTGGGCGCACCACCGG + Intronic
1084146489 11:67267580-67267602 AGGTGTGCTGGGAGGGCCCCTGG - Intronic
1091153070 11:133347271-133347293 ACTTGTGCTGGCTGCTCCCAGGG - Intronic
1091170490 11:133516048-133516070 ACGTGTGCAGGGCGCTTATCGGG + Intronic
1202825118 11_KI270721v1_random:86070-86092 AGGTGGGCAGGGGGCTCCCCAGG + Intergenic
1202827590 11_KI270721v1_random:95591-95613 CCTTGTGCTGGGGGCTCTCCTGG + Intergenic
1096673173 12:53211958-53211980 GCCTGTGCTGGGCGCCCCCTAGG - Intronic
1102812678 12:115837977-115837999 ACATGTGGGGGGCGCTGCCCAGG - Intergenic
1104071543 12:125350134-125350156 ACGCTTGCTGGGGGCTCTCCAGG - Exonic
1117913907 14:60657543-60657565 AGGTGGGCTGAGCGGTCCCCAGG - Intronic
1118456287 14:65948044-65948066 AGGTGTGCTGAGCTCTCCCCAGG - Intergenic
1119722319 14:76899589-76899611 AGGAGTGCTGTGTGCTCCCCAGG + Intergenic
1121889523 14:97576066-97576088 ACGTGTGCTGGACAGTACCCTGG + Intergenic
1122928167 14:104919376-104919398 TCGTGTGCAGGTCCCTCCCCCGG - Intergenic
1123014069 14:105365245-105365267 CCCTGAGCTGGGCACTCCCCTGG - Intronic
1131110202 15:89760203-89760225 ACAGGGGCTGGGTGCTCCCCAGG - Intergenic
1131258334 15:90875837-90875859 ACGTGGGCTGTGCGCATCCCTGG + Exonic
1132546169 16:534383-534405 ACAGGTGCAGGCCGCTCCCCAGG - Intronic
1136413264 16:30089255-30089277 ACTGGTGCTGGGCCCACCCCTGG - Intronic
1140192325 16:72828635-72828657 ACCTGTGCAGGGCCCTGCCCAGG + Intronic
1140411092 16:74740829-74740851 AGGTGCCCTGGGCGCTACCCTGG - Intronic
1140439343 16:74975019-74975041 ACTTGTGTTGGGGGTTCCCCAGG - Intronic
1141599234 16:85115149-85115171 AAGTGGGCTGGGCGGTCCCCGGG + Intergenic
1142224655 16:88871648-88871670 AGGAGTGATGGGTGCTCCCCAGG - Intergenic
1143028749 17:3955682-3955704 GCTTGTGCTGGGCTCTTCCCGGG + Intronic
1144788618 17:17845400-17845422 AGTTTTGCTGGGGGCTCCCCAGG + Intronic
1150389011 17:64780341-64780363 ACGTCTGCTGGGCGGGCCTCAGG + Intergenic
1150390166 17:64785367-64785389 AGGTGTGCTGCTCTCTCCCCAGG - Intergenic
1152007543 17:77691912-77691934 AGGTGTGCAGGGCTCTCCCCGGG + Intergenic
1152682586 17:81676810-81676832 AGGGGTGCTGGGGACTCCCCTGG - Intergenic
1159991322 18:74912103-74912125 CTGTGTGCTGGGCACTCTCCTGG + Intronic
1160720168 19:593721-593743 AGGCATGCTGGGCGCTTCCCTGG + Intronic
1160957702 19:1701321-1701343 AGCTGTGATGGGGGCTCCCCAGG - Intergenic
1161055082 19:2186858-2186880 TGGTGTGCTGGGCCCTTCCCTGG + Intronic
1161076814 19:2289888-2289910 ACGGCTGCACGGCGCTCCCCAGG - Exonic
1166659067 19:44633873-44633895 AGCTGTGCTGTGCGCTCTCCTGG + Intronic
1167509307 19:49887867-49887889 CCCTGAGCTGGGCGCTGCCCAGG + Intronic
1168339225 19:55614140-55614162 GCCTGGGCTGGGCGCTCCCGCGG + Exonic
925188337 2:1864510-1864532 AAGTTTGCTGGACACTCCCCAGG + Intronic
927707353 2:25304677-25304699 TCATGTGCAGGGCGGTCCCCAGG + Intronic
927905154 2:26849819-26849841 CCGTGTGGGAGGCGCTCCCCCGG + Intronic
928332282 2:30366776-30366798 TCGTGTGCTGGGTGGGCCCCAGG - Intergenic
933847580 2:86337809-86337831 GCGCGTCCTGCGCGCTCCCCGGG + Intronic
938063175 2:128267628-128267650 GGGTGAGCTGGGGGCTCCCCAGG + Exonic
946137070 2:217656304-217656326 AAGTGGCCTGGGCCCTCCCCAGG - Intronic
948537242 2:238655245-238655267 AGGTGTGCTGGGTCCTGCCCCGG + Intergenic
1173125166 20:40329994-40330016 TGCTGTGCTGGGCACTCCCCGGG - Intergenic
1173571824 20:44081948-44081970 ACGTGTGCTGGGGCCTCTGCTGG + Intergenic
1174212587 20:48891742-48891764 AAGTGTGCTGGGCTCTCCCCAGG + Intergenic
1175913703 20:62416092-62416114 ACGTGTGCTGGGTGCTGCTCGGG + Intronic
1176195593 20:63835293-63835315 ACGTGTGGTGGGCGGCTCCCTGG - Intergenic
1179481614 21:41682110-41682132 TCTGGTGCTGGGGGCTCCCCAGG - Intergenic
1180711723 22:17843672-17843694 ATGTTTCCTGGGCACTCCCCAGG - Intronic
1183226062 22:36550713-36550735 TCCTGGGCTGGGCGCTCCCTGGG - Intergenic
1183282298 22:36938194-36938216 ACATCTGCCGGGCGTTCCCCTGG - Exonic
1183506036 22:38209464-38209486 AGGTGTGCTGGGACCTCCCCAGG + Intronic
1184088937 22:42282513-42282535 GCCAGGGCTGGGCGCTCCCCCGG - Intronic
1184235741 22:43182159-43182181 ACATGAGCTGGGAGCTCCCAGGG + Intronic
1184297055 22:43531697-43531719 ACGTATGATGTGTGCTCCCCAGG + Intronic
1184671485 22:46014155-46014177 ACCTGTGCTGGGGGCCGCCCGGG - Intergenic
1185337148 22:50275835-50275857 TGGGGTGCTGGGCGGTCCCCCGG - Intronic
959021344 3:101190807-101190829 ACATGTGATGGGCTCTCCCAGGG - Intergenic
961456466 3:127027102-127027124 ACGTGTGCTGGGCGCTCCCCAGG + Intronic
968480178 4:829828-829850 ACGGGTTCAGGGCGCTTCCCAGG - Intergenic
971156159 4:24085527-24085549 AGGTGTACTGGGTGCTCACCAGG - Intergenic
976282087 4:83335180-83335202 ACGTGTTCTGCGCGCTCTCGTGG + Intergenic
983229121 4:165112453-165112475 ACGTGGGCTGGGCGCCAGCCTGG + Intronic
985642422 5:1069997-1070019 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642436 5:1070050-1070072 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642446 5:1070092-1070114 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642456 5:1070134-1070156 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642470 5:1070187-1070209 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642480 5:1070229-1070251 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642490 5:1070271-1070293 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642498 5:1070311-1070333 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642508 5:1070353-1070375 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642516 5:1070393-1070415 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642525 5:1070434-1070456 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642534 5:1070475-1070497 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642548 5:1070528-1070550 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642557 5:1070569-1070591 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642567 5:1070611-1070633 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642576 5:1070652-1070674 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642584 5:1070692-1070714 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642593 5:1070733-1070755 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642607 5:1070786-1070808 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642616 5:1070827-1070849 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642625 5:1070868-1070890 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642635 5:1070910-1070932 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642645 5:1070952-1070974 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642655 5:1070994-1071016 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642664 5:1071035-1071057 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642673 5:1071076-1071098 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642681 5:1071116-1071138 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642690 5:1071157-1071179 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642699 5:1071198-1071220 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642708 5:1071239-1071261 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642721 5:1071291-1071313 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642730 5:1071332-1071354 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642739 5:1071373-1071395 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642748 5:1071414-1071436 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642757 5:1071455-1071477 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642767 5:1071497-1071519 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642775 5:1071537-1071559 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642784 5:1071578-1071600 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642794 5:1071620-1071642 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642804 5:1071662-1071684 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642813 5:1071703-1071725 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642823 5:1071745-1071767 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642831 5:1071785-1071807 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642840 5:1071826-1071848 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642850 5:1071868-1071890 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642860 5:1071910-1071932 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642870 5:1071952-1071974 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642879 5:1071993-1072015 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642892 5:1072045-1072067 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642902 5:1072087-1072109 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642916 5:1072140-1072162 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642925 5:1072181-1072203 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642939 5:1072234-1072256 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642948 5:1072275-1072297 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642971 5:1072370-1072392 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642980 5:1072411-1072433 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985642994 5:1072464-1072486 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643008 5:1072517-1072539 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643017 5:1072558-1072580 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643030 5:1072610-1072632 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643053 5:1072705-1072727 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643066 5:1072757-1072779 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643076 5:1072799-1072821 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643089 5:1072851-1072873 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643099 5:1072893-1072915 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643113 5:1072946-1072968 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643123 5:1072988-1073010 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643133 5:1073030-1073052 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643147 5:1073083-1073105 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643157 5:1073125-1073147 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643171 5:1073178-1073200 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643181 5:1073220-1073242 CCGTGTGCTGGGGGCTCACTGGG - Intronic
985643191 5:1073262-1073284 CCGTGTGCTGGGGGCTCACTGGG - Intronic
997581450 5:135019896-135019918 CCGTGAGCTGGGCTCTTCCCAGG - Intergenic
1002670238 5:180861005-180861027 AGGGGTGCAGGGCGCGCCCCTGG - Intronic
1004881104 6:20009318-20009340 AGCTGTGCTGGATGCTCCCCTGG - Intergenic
1015376777 6:132518748-132518770 ACGTGTGGTGGCCCCTCCCCCGG - Intergenic
1017819461 6:158038863-158038885 GCGTGTGCTGCGCGCAGCCCAGG + Intronic
1019328606 7:451987-452009 ACCTGTGCTGGGCTCTGCGCAGG - Intergenic
1019712973 7:2525767-2525789 ACCTGTGCAGGGCACTCACCTGG - Exonic
1019938854 7:4273639-4273661 ACGTGTGCTGAGGGCTCTGCAGG - Intergenic
1020245129 7:6423912-6423934 ACGTGAACAGGGCGCCCCCCGGG + Intronic
1024505575 7:50158767-50158789 GCGTGCCCTGGGCCCTCCCCAGG + Intronic
1025675021 7:63636035-63636057 AAGTGCGCTGGGCCCTCCCATGG + Intergenic
1026489129 7:70847719-70847741 AGGTGTGCTGGGAGCTCCAGGGG - Intergenic
1029473053 7:100766685-100766707 AGGTGAGCTGGGGGCTGCCCAGG + Intronic
1036750960 8:11443584-11443606 TCTTGTGCTGGGCGCTGGCCGGG - Intronic
1049273574 8:141708695-141708717 AGGTGGGCTGGGCTTTCCCCAGG + Intergenic
1049613873 8:143567975-143567997 ACCTGCCCTGGGGGCTCCCCTGG - Intronic
1049664532 8:143837098-143837120 CCGTGTGCTGGCCCCACCCCCGG - Exonic
1049800707 8:144516295-144516317 ACCTGTGCGGGGCTCTCCCAGGG + Exonic
1051362412 9:16293074-16293096 CTGTGTGCTGGGGGCTCCCATGG - Intergenic
1053620531 9:39809796-39809818 GCGTGTGCCGGGCGCTCCGCTGG + Intergenic
1053626173 9:39874138-39874160 GCGTGTGCCGGGCGCTCCGCTGG - Intergenic
1053878700 9:42569094-42569116 GCGCGTGCCGGGCGCTCCGCTGG + Intergenic
1054217715 9:62376563-62376585 GCGTGTGCCGGGCGCTCCGCTGG + Intergenic
1054232988 9:62532601-62532623 GCGCGTGCCGGGCGCTCCGCTGG - Intergenic
1054263629 9:62897647-62897669 GCGCGTGCCGGGCGCTCCGCTGG - Intergenic
1056463486 9:86830541-86830563 ACGTGTGCTGAGTCTTCCCCAGG - Intergenic
1057441052 9:95083746-95083768 ACGTGTGCTGTGTGCGCCGCGGG - Intronic
1060005819 9:119998455-119998477 TCTGGTGCTGGGCCCTCCCCGGG - Intergenic
1061675728 9:132214465-132214487 ATCTGGGCTGGGCTCTCCCCTGG + Intronic
1062621353 9:137423757-137423779 AGGGGCGCTGGGCCCTCCCCAGG - Intronic
1185467657 X:364163-364185 ACGCGTTCTGGGAGCTTCCCCGG - Intronic
1185506443 X:634874-634896 ACGCGTGCTGTGCGCTCCCGAGG - Intronic
1189273334 X:39767215-39767237 CAGTGTGCTGGGCGTCCCCCAGG + Intergenic
1197715275 X:129701946-129701968 ACGTTTGCTGGCCCCTTCCCAGG - Intergenic