ID: 961458978

View in Genome Browser
Species Human (GRCh38)
Location 3:127038328-127038350
Sequence GAGGCTGGTGGGAGACAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 1, 2: 16, 3: 100, 4: 699}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961458978_961458986 -2 Left 961458978 3:127038328-127038350 CCCACCTGTCTCCCACCAGCCTC 0: 1
1: 1
2: 16
3: 100
4: 699
Right 961458986 3:127038349-127038371 TCTCCATGAACTCGTTCCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 123
961458978_961458985 -3 Left 961458978 3:127038328-127038350 CCCACCTGTCTCCCACCAGCCTC 0: 1
1: 1
2: 16
3: 100
4: 699
Right 961458985 3:127038348-127038370 CTCTCCATGAACTCGTTCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 84
961458978_961458988 8 Left 961458978 3:127038328-127038350 CCCACCTGTCTCCCACCAGCCTC 0: 1
1: 1
2: 16
3: 100
4: 699
Right 961458988 3:127038359-127038381 CTCGTTCCCAGGGCTGACAGTGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961458978 Original CRISPR GAGGCTGGTGGGAGACAGGT GGG (reversed) Intergenic
900014572 1:139129-139151 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
900044438 1:494331-494353 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
900065844 1:729237-729259 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
900140188 1:1136606-1136628 GAGGCAGGAGGGGGTCAGGTGGG + Intergenic
900178156 1:1299715-1299737 AGGGCAGGTGGGAGACAGGCAGG + Intronic
900315783 1:2055708-2055730 GGGGATGGTGGGAAAGAGGTTGG + Intronic
900532032 1:3159169-3159191 GAGGCTGGAGGTACACAGGGCGG + Intronic
900599526 1:3497116-3497138 CAGGCTGGGTGGAGACAGGCAGG + Exonic
900782438 1:4626801-4626823 CAGGCTGCTGGGATACAGCTGGG + Intergenic
900887127 1:5423082-5423104 GTGGCAGGTGGGAGACAGCCTGG - Intergenic
900932910 1:5747876-5747898 GAGGCAGGAGGGAGAAAGGAAGG + Intergenic
901068850 1:6507481-6507503 CAGGCTGGGGGGGCACAGGTGGG - Intronic
901399746 1:9007569-9007591 GAGGCTGGAGGGAGCCCTGTGGG - Intronic
901641038 1:10693210-10693232 GAGGCAGGTGGGAGACAGTCCGG + Intronic
901648456 1:10729065-10729087 GAGGCGGTTGGGAGGCAGCTGGG + Intronic
901773924 1:11546093-11546115 GAGCCAGCTCGGAGACAGGTCGG + Intergenic
902193465 1:14780279-14780301 GAGGCTGGGAAGAGACAGGGAGG - Intronic
902512288 1:16973004-16973026 GACGTCGGGGGGAGACAGGTAGG + Intergenic
902569298 1:17336625-17336647 GAGGCGGGAAGGAGCCAGGTGGG + Intronic
902628874 1:17692945-17692967 GAGGCTGCTGGGTGACAAGGCGG - Intronic
903008595 1:20314669-20314691 CAGGGTGGGGGGAGACAGGGAGG + Intronic
903013505 1:20346996-20347018 CAGGCTGGTCATAGACAGGTGGG - Intronic
903186685 1:21633255-21633277 GAGGCTGGAGGGAGTCAGCAGGG - Intronic
903350350 1:22713009-22713031 GAGGCTGGTTGGAATCTGGTGGG + Intronic
903569440 1:24293687-24293709 GAGATGGGTGGGGGACAGGTGGG - Intergenic
904013097 1:27401324-27401346 GAGGCTGGGGAGAGACAGGTTGG - Intergenic
904311804 1:29633970-29633992 GAGGCTGGAGGGAAGCAGATGGG + Intergenic
904741035 1:32676020-32676042 GAGGCTGCTGTGAGACATGGTGG + Intronic
904917671 1:33982077-33982099 CAGGCTAGTGGGTGACAGGACGG + Intronic
905242510 1:36589951-36589973 GGGGCTGGTGGGAGAGGGTTGGG + Intergenic
905395762 1:37665457-37665479 GAGGAGGATGGGGGACAGGTTGG - Intergenic
905690743 1:39940962-39940984 GAAGATGCTGGGACACAGGTTGG + Intergenic
905821919 1:40999273-40999295 GAGGCTGTCTGGAGACAGGCTGG + Intronic
906610479 1:47198455-47198477 GAGGCTGGAGGGAGTCAGTGTGG + Intergenic
907053262 1:51344069-51344091 GACGGGGGTGGGAGAAAGGTAGG + Intronic
907301590 1:53490247-53490269 GAGGAAGGTGGGAGACAGGGTGG - Intergenic
907319248 1:53592522-53592544 AGGGCTGCTGGGAGACAGCTGGG - Intronic
907326922 1:53644263-53644285 GAGGCTGGAGGTGGACAGGATGG - Intronic
907372992 1:54014889-54014911 GAGTCTGCTGGGATGCAGGTTGG + Intronic
907429918 1:54405879-54405901 GCGGGCGGTGGGAGGCAGGTGGG - Intronic
907758318 1:57332863-57332885 GTGGCTGGTGGGAGGCAGACAGG - Intronic
907978241 1:59454638-59454660 TAATCTGGTGGGAGACAGGGAGG - Intronic
908567362 1:65370903-65370925 GAGGTTGGTGGGAGATTGGCTGG + Intronic
908664362 1:66473718-66473740 GAACCTGGTGGCAGAAAGGTTGG - Intergenic
909289513 1:73864603-73864625 GAGGCTGGAGGGTGACAGGAGGG + Intergenic
911196451 1:94999918-94999940 GAGGGTTGTGGGAACCAGGTGGG - Intronic
912497277 1:110099751-110099773 GGGGGTGGTGGGAGAAAGATGGG + Intergenic
912505073 1:110150671-110150693 GCGGCGGGCGGGAGCCAGGTTGG + Exonic
914521943 1:148425582-148425604 GAAGCTGGTGGGAGTCATGGCGG - Intergenic
915063066 1:153202833-153202855 GAGGCTGGAGTGCGAAAGGTGGG - Intergenic
915107984 1:153546148-153546170 GGGGGTGGTGGGTGACAGGTGGG + Intronic
915930438 1:160057582-160057604 GAGGCTGGGGGCAGACAAGAGGG - Intronic
916056725 1:161073361-161073383 GAGGCTGGTGGAGGACAAGAGGG - Intronic
916075946 1:161200074-161200096 GTGGATGGTGGGAGCCAGGTGGG - Intronic
916107482 1:161442017-161442039 GAGGCCGGTGGGAGGAAGGAGGG - Intergenic
916110654 1:161456816-161456838 GAGGCCGGTGGGAGGAAGGAGGG - Intergenic
916156108 1:161850343-161850365 GAGGCAGGTGGGGGAAAGGTGGG - Intronic
916720610 1:167482512-167482534 GAGGCTGAGGGGAGAAAGGAAGG - Intronic
916824001 1:168426952-168426974 GTGGCTGGTGGCAGAGAGGGTGG + Intergenic
916833551 1:168518081-168518103 GAGCCTGATGGGAGAGAGCTAGG + Intergenic
918083019 1:181221923-181221945 GAGGCTCCTGAGAGACGGGTAGG - Intergenic
919025923 1:192170274-192170296 GAGCCTAGTGGGAGACATTTGGG + Intronic
919101894 1:193105713-193105735 GAGGATGGTGGCAGACATGCTGG + Exonic
919559976 1:199105370-199105392 GAGGGTGGAGGGTGACAGGTGGG - Intergenic
919795677 1:201320174-201320196 GAGTGTGGTGGGGGACAGGCAGG - Intronic
919922317 1:202174036-202174058 CAGGCTGGTGGGGGGCAGGGTGG + Intergenic
920043387 1:203118079-203118101 GAGGCTGGGGGGAGGGAGGTGGG - Intronic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920298727 1:204975614-204975636 GGAGCTGGTGGGAGAGAGGGAGG - Intronic
920546445 1:206822350-206822372 GAGGCTGGTGGGTGATATGGAGG + Intronic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
922100967 1:222476586-222476608 TAGGCTGCTGGGAGACAAGCAGG + Intergenic
922733648 1:227968086-227968108 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
922914326 1:229243340-229243362 GAGGAAGGAGGGAGACAGGAGGG + Intergenic
923478413 1:234359128-234359150 GAAACAGGTGGGAGACAGGCCGG - Intergenic
923558460 1:235020550-235020572 GAGGCTGGGGGGTGACAGATGGG + Intergenic
923888944 1:238189699-238189721 GAGTCTAATGGGAGACAGGTTGG - Intergenic
924343894 1:243056703-243056725 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1063161323 10:3420908-3420930 GACGCAGGTGGGATGCAGGTGGG + Intergenic
1063161325 10:3420919-3420941 GATGCAGGTGGGACGCAGGTAGG + Intergenic
1063371299 10:5524665-5524687 GCGGCAGGTGGGAGACGGGGAGG + Exonic
1064531375 10:16313942-16313964 GAGGCTGGTGGGATAAACGGAGG - Intergenic
1065909094 10:30285916-30285938 GAGCCTGGCTGGAGACAGGCTGG + Intergenic
1066315441 10:34241402-34241424 GAGGGTGGTGGGAGACCCGGTGG + Intronic
1066732437 10:38448360-38448382 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1067435354 10:46272948-46272970 GAAACTGGTGGGAGGGAGGTAGG - Intergenic
1067549902 10:47226954-47226976 GAGGCTGGAGGCAGCCAGGGAGG + Intergenic
1068318856 10:55383186-55383208 GAGCCTGGCTGGAGACAGCTGGG - Intronic
1068757494 10:60671231-60671253 GAGGATGGTGAGGGACAGGTGGG - Intronic
1069897288 10:71687598-71687620 GAGGCTGCAGGGAGGCAGGTGGG - Intronic
1070539439 10:77405840-77405862 CAGGCACGTGGGAGGCAGGTGGG + Intronic
1070572326 10:77649832-77649854 GAGCCTGTTGGGAGCCAGGCAGG + Intergenic
1070697178 10:78572026-78572048 GTGGGTGGTGGGGCACAGGTGGG + Intergenic
1070828584 10:79405260-79405282 GAGGCTTGTGGGAAACAAGATGG - Intronic
1071329796 10:84548183-84548205 GAGGCTGATGGGAAAAAGGAGGG - Intergenic
1071417089 10:85451468-85451490 GAGAGAGGTGGGAGACAGGCGGG - Intergenic
1071468157 10:85959519-85959541 GGGGCGGGTGGGAGACTGGCTGG - Intronic
1071713903 10:88076067-88076089 GTGGCTGGTGAGTGAGAGGTAGG + Intergenic
1072451703 10:95544110-95544132 GAGGCTGGACGGAGAACGGTAGG + Intronic
1072634522 10:97169389-97169411 GATCCTGGTGGGAGAGAGGGTGG - Intronic
1072636498 10:97181767-97181789 GAGGATGGAGGGAGGCAGGCAGG - Intronic
1072690773 10:97571040-97571062 GAGGCGGGTGGTGGACAGCTGGG + Exonic
1073412070 10:103350727-103350749 GAGGCTGGAGGGAGGCCGGCAGG - Exonic
1073472289 10:103730402-103730424 GGGGCTGGAAGGACACAGGTGGG - Intronic
1073524040 10:104162783-104162805 GAGCCAGGTGGGAGAGAAGTTGG + Intronic
1074320008 10:112392968-112392990 GTGGCTGGTGGCAGACTGGATGG + Intronic
1074954076 10:118370261-118370283 GAAGCAGGTTGGAGAAAGGTTGG + Intergenic
1074976386 10:118585308-118585330 GAGGTGGGTGGGTGTCAGGTCGG - Intergenic
1075566067 10:123505215-123505237 GAGCCTGGTGCCAGACAGGCAGG - Intergenic
1075799144 10:125141997-125142019 GGGGCTGGTGGGACACAGTGTGG + Intronic
1076316662 10:129546642-129546664 GAGGCTGGAAGGAGAGAGGCGGG + Intronic
1076462502 10:130656371-130656393 GAGGCAGGATGGAGACAGGCAGG - Intergenic
1076530648 10:131142206-131142228 GGGGCAGGTGGGATCCAGGTGGG + Intronic
1076595666 10:131623243-131623265 GAGAGAGGTGGGAGAGAGGTGGG + Intergenic
1076595744 10:131623466-131623488 GAGAAAGGTGGGAGAGAGGTGGG + Intergenic
1076595752 10:131623490-131623512 GAGAGAGGTGGGAGAGAGGTGGG + Intergenic
1076595760 10:131623514-131623536 GAGAGAGGTGGGAGAGAGGTGGG + Intergenic
1076595839 10:131623717-131623739 GAGAGAGGTGGGAGAGAGGTGGG + Intergenic
1076595855 10:131623761-131623783 GAGAGAGGTGGGAGAGAGGTGGG + Intergenic
1076595858 10:131623772-131623794 GAGAGAGGTGGGAGAGAGGTGGG + Intergenic
1076595884 10:131623832-131623854 GAGAGAGGTGGGAGAGAGGTGGG + Intergenic
1076595939 10:131623968-131623990 GAGAGAGGTGGGAGAGAGGTGGG + Intergenic
1076595952 10:131624003-131624025 GAGAGAGGTGGGAGAGAGGTGGG + Intergenic
1076595970 10:131624037-131624059 GAGGGAGGTGGGGGAGAGGTGGG + Intergenic
1076596027 10:131624186-131624208 GAGAGAGGTGGGAGAGAGGTGGG + Intergenic
1076596030 10:131624197-131624219 GAGAGAGGTGGGAGAGAGGTGGG + Intergenic
1076797516 10:132805407-132805429 GAGGCTGATGGGAGCCAGAAAGG + Intergenic
1076806792 10:132862796-132862818 GAGGCTGGAGGGGGACGGGGCGG + Intronic
1076970768 11:130806-130828 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1077159344 11:1105635-1105657 GAGGCAGGAGGGAGGCAGGAGGG - Intergenic
1077204549 11:1336344-1336366 GAGGAGGGTGGGAGAGAGGGCGG - Intergenic
1077253222 11:1569891-1569913 GAGGCTGAGGAGAGACTGGTGGG + Intronic
1077324690 11:1958687-1958709 GAGGCCTGTGGGAGACATGGGGG - Intronic
1077379595 11:2223567-2223589 GAGCCTGGTAGGAGGCAGGTAGG + Intergenic
1077455268 11:2674432-2674454 GAGGCTGGGGGGAGGCACGTGGG + Intronic
1077480632 11:2812802-2812824 GAGGCTGGGTGGAGTCAGGAAGG - Intronic
1077560495 11:3257435-3257457 GATGCAGGTGGGATGCAGGTGGG - Intergenic
1077560550 11:3257677-3257699 GATGCAGGTGGGACTCAGGTAGG - Intergenic
1077560552 11:3257688-3257710 GATGCAGGTGGGATGCAGGTGGG - Intergenic
1077560570 11:3257776-3257798 GATGCAGGTGGGACTCAGGTGGG - Intergenic
1077560579 11:3257820-3257842 GATGCAGGTGGGACTCAGGTGGG - Intergenic
1077560582 11:3257831-3257853 GATGCAGGTGGGATGCAGGTGGG - Intergenic
1077566449 11:3303516-3303538 GATGCAGGTGGGACTCAGGTAGG - Intergenic
1077566451 11:3303527-3303549 GATGCAGGTGGGATGCAGGTGGG - Intergenic
1077566469 11:3303615-3303637 TAGGCAGGTGGGACTCAGGTAGG - Intergenic
1077566477 11:3303659-3303681 GATGCAGGTGGGATGCAGGTGGG - Intergenic
1077577943 11:3398550-3398572 GAGGTGTGTGGGAGACAGCTTGG + Intergenic
1078559064 11:12354984-12355006 GCTGCTGGTGGGAGGCAGGCTGG - Intronic
1080623587 11:34008224-34008246 GAAGCTGGTGGGACACTGGTGGG + Intergenic
1081567753 11:44270344-44270366 GAGGCGGGTGAGCGACCGGTGGG + Intronic
1082180158 11:49107063-49107085 GAGTGGGGTGGGGGACAGGTGGG + Intergenic
1082260371 11:50073109-50073131 GAGTCTGCTGGGAGGCAGGCAGG + Intergenic
1082261045 11:50076469-50076491 CAGGCTGCTGGGAGACAGGTAGG + Intergenic
1082261141 11:50076952-50076974 GAGGATGCTGGGAGGCAGGCAGG + Intergenic
1082261283 11:50077718-50077740 AAGGCTGCTGGGAGGCAGGTAGG + Intergenic
1083052278 11:59787989-59788011 GAGGATGGCAGGAGACAGGCTGG - Intronic
1083366350 11:62143781-62143803 GAGTCTACTGGGAGCCAGGTTGG + Intronic
1083612105 11:64009278-64009300 GAGGGAGGTGGGAGAGAGGAGGG + Intronic
1083658101 11:64239843-64239865 GAGGCTGCAGGGAGAAGGGTAGG - Intergenic
1083740111 11:64705245-64705267 GAGGCAGCATGGAGACAGGTAGG + Intronic
1083780339 11:64914302-64914324 GAGGCTGGGGGCAGGCAAGTGGG - Intronic
1084428373 11:69097821-69097843 GAGGCTGCTGGGATCCAGGTGGG - Intergenic
1084537273 11:69764553-69764575 GAGGCTGCTGGGGGAGGGGTGGG + Intergenic
1084944544 11:72631684-72631706 GGTGCTGGTAGGATACAGGTCGG - Intronic
1085079551 11:73622815-73622837 GAAGGTGGTTTGAGACAGGTGGG + Intergenic
1085455445 11:76662861-76662883 GTGGGAGGTGGGGGACAGGTTGG - Intronic
1087070536 11:94075368-94075390 AATGCTGATGGGACACAGGTAGG + Exonic
1088812089 11:113398945-113398967 GAGTCTGCTGGGAGAAAGATGGG - Exonic
1089375510 11:117991552-117991574 GAAGCTGGAAGGAGGCAGGTGGG - Intronic
1089711342 11:120317077-120317099 GAGGCAGGAGGTAGTCAGGTGGG + Intronic
1089730047 11:120513676-120513698 GAGGCAGGCGGGAGGCTGGTGGG - Intronic
1089733671 11:120535207-120535229 GAGCCTGGTGGGTGGCAGATGGG + Intronic
1090022278 11:123138588-123138610 GAGGGGGGTGGGGGGCAGGTGGG - Intronic
1090406577 11:126479324-126479346 GAGGCTGGTGAGAGAAAGGTTGG - Intronic
1091248240 11:134118570-134118592 GGGGTTGGTGGGAGACAGGCAGG - Intronic
1202807669 11_KI270721v1_random:13864-13886 GAGGCCTGTGGGAGACATGGGGG - Intergenic
1091556081 12:1574443-1574465 GAGGCTGGTGGCAGCCGTGTGGG + Intronic
1091798185 12:3309083-3309105 TGGGCTGGAGGGAGACAGTTGGG + Intergenic
1091807832 12:3368197-3368219 GGTGATGGTGGGAGACAGGCAGG + Intergenic
1092086798 12:5769264-5769286 CAGGCTGATGGGGTACAGGTGGG + Intronic
1092291156 12:7160186-7160208 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291184 12:7160267-7160289 GAGGCAGGTGGGAGGCAGGCGGG - Intergenic
1092291204 12:7160324-7160346 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291208 12:7160335-7160357 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291212 12:7160346-7160368 AAGGCAGGTGCGAGGCAGGTGGG - Intergenic
1093816066 12:23548985-23549007 GGGGATGGCTGGAGACAGGTGGG - Intronic
1094535441 12:31318391-31318413 GAGGCTGTTGGCAAACAAGTGGG - Intronic
1094747179 12:33358281-33358303 GAGGCTGGAGAGAAATAGGTAGG - Intergenic
1095331964 12:40977044-40977066 GAGGTTGCTGGGATACAGCTTGG + Intronic
1095769853 12:45941627-45941649 AAGGCTGGTGGGAGAACGTTTGG - Intronic
1096640736 12:52992345-52992367 TATGCTGTTGGGGGACAGGTAGG + Intergenic
1096741288 12:53695766-53695788 GGGGCTGCAGGGAGACAGGTGGG + Intergenic
1096797153 12:54085111-54085133 GAGGCTGGTGGGGGAAAGAGAGG - Intergenic
1096805149 12:54136046-54136068 GAGGCAGGTGGGGGACAAGAGGG + Intergenic
1096826857 12:54285866-54285888 GAGGGTGGTGGGAGGTGGGTGGG + Intronic
1097199955 12:57269880-57269902 GAGGGTGCTGGGAGATAAGTGGG + Exonic
1097990498 12:65826727-65826749 GTGGCGGGTGGGAAACAAGTGGG - Intronic
1098287243 12:68919953-68919975 GAGCCTGGTGGGAGACGTTTGGG + Intronic
1100695254 12:97085659-97085681 GAGGCAGGTGGTAGAGAGGTGGG - Intergenic
1101969284 12:109301477-109301499 GAGGATGGAAGGAGAGAGGTGGG - Intronic
1101992639 12:109499840-109499862 GAAGATGGTGGGAGAGAGGCAGG - Intronic
1102179476 12:110901567-110901589 GTGGCAGGTGGGAGGGAGGTGGG - Intronic
1102826254 12:115950121-115950143 GAGGCAGGTTGCAGACAGGATGG + Intergenic
1102926395 12:116829408-116829430 GGGACTGGTGGGAGTCAGGAGGG + Intronic
1103073070 12:117960887-117960909 GAGGATGGTTGGAGACTGGAAGG - Intronic
1103177296 12:118875567-118875589 ATGGCTGGAGCGAGACAGGTGGG + Intergenic
1103566756 12:121819917-121819939 GAGGGTGGTGGGAGGGAGGCAGG + Intronic
1103662001 12:122527445-122527467 GACGCTGGCAGGAGAGAGGTTGG + Intronic
1104165756 12:126228099-126228121 CAGGCTGTTGGGGGACAGTTAGG - Intergenic
1104363434 12:128154969-128154991 GAGGATGGATGGAGAGAGGTGGG + Intergenic
1104396544 12:128438761-128438783 GAGGCTTTGGGGAGACAGGAGGG - Intronic
1104937579 12:132374803-132374825 CACGGGGGTGGGAGACAGGTGGG + Intergenic
1104959927 12:132483812-132483834 GAGGCAGGTGGGCCTCAGGTGGG + Intergenic
1105857822 13:24387616-24387638 GAGGTGGGTGGGAGATAGCTGGG - Intergenic
1105969188 13:25412732-25412754 CAGGCTGGTGGGTGACCAGTTGG - Intronic
1106197112 13:27503368-27503390 GAGGCTGGTGTCAGGCAGGAAGG + Intergenic
1106384150 13:29267831-29267853 AAGGGTGGTGGGAGACAGGAAGG + Intronic
1107170708 13:37339776-37339798 GAGGCTGGGGAGAGGCAGTTGGG - Intergenic
1107602492 13:42028136-42028158 GAGGCTGATGGCAGACTGGGGGG - Intergenic
1108967080 13:56321875-56321897 GAGGCTGGAGGGTGAAGGGTGGG - Intergenic
1111171731 13:84535389-84535411 GAAGCTTGTGGGAAGCAGGTGGG + Intergenic
1113341204 13:109427852-109427874 GAGGAAGAGGGGAGACAGGTGGG + Intergenic
1113567226 13:111326346-111326368 GGGGCTGGTGGGTGTCTGGTGGG + Intronic
1113803046 13:113096352-113096374 GAACCTGGTGGGAGACGGGCAGG - Exonic
1117764037 14:59061358-59061380 GAGGCTGTGGGGAGACAGAGTGG - Intergenic
1117964262 14:61190634-61190656 CAGGGTGGTGGGAGACAGGCTGG - Intronic
1118680434 14:68236057-68236079 GAGGGTGGAGGGAGGCAGGAGGG + Intronic
1118855697 14:69620347-69620369 CAGACTGGTGGGAGGCTGGTAGG + Intronic
1119195781 14:72715815-72715837 GAGACTGGTGGGAGGGAGGGAGG - Intronic
1120219620 14:81717472-81717494 GTGGCAGGTGGGAGTCAGGAAGG + Intergenic
1121488334 14:94338764-94338786 GTGGGTGGTGGGAGCCAGGTTGG - Intergenic
1121525468 14:94616225-94616247 CAGGCAGGTGGTAAACAGGTGGG + Intronic
1121567293 14:94919602-94919624 GAGTGTGGTGGAAGAAAGGTAGG + Intergenic
1121609720 14:95269630-95269652 GAGCCTGGTGGGGTTCAGGTTGG - Intronic
1122092861 14:99351685-99351707 GAGCCTGCTGTGAGACAGGCGGG - Intergenic
1122097292 14:99381236-99381258 GAGGCATCTGGCAGACAGGTGGG - Intergenic
1122170215 14:99867073-99867095 AAGGAGGGTGGGAGAGAGGTGGG - Intronic
1122194501 14:100074891-100074913 CAGGCTGAGGGGAGACAGGGTGG + Intronic
1122203687 14:100137674-100137696 GAGGCTGGTGGGGCAGAGGCGGG + Intronic
1122447663 14:101781478-101781500 GAGGCTGGGGGGCGGCAGGAGGG - Intronic
1122487404 14:102090264-102090286 TGGCCTGGTGGGAGGCAGGTGGG - Intronic
1122913726 14:104846206-104846228 GCTGCTGGTGGGTGACAGGCAGG + Intergenic
1123058609 14:105584256-105584278 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1123082940 14:105704490-105704512 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1123679161 15:22745259-22745281 GAGGTGGGTGGCAGACAGGCCGG + Intergenic
1123996370 15:25720632-25720654 GAGGCTGGTGGGAGGGAGGATGG + Intronic
1124331380 15:28819709-28819731 GAGGTGGGTGGCAGACAGGCCGG + Intergenic
1124693155 15:31842562-31842584 GGGGCTGGTGGGGGACAGAGAGG + Intronic
1124711080 15:32012476-32012498 GAGGTTGGGGGTGGACAGGTGGG - Intergenic
1126831020 15:52605359-52605381 GAAGCTGGTGATATACAGGTGGG + Intronic
1127762126 15:62149829-62149851 GAGGCAGGGAGGAGACAGGAAGG + Intergenic
1128113565 15:65091631-65091653 GAGGCATGTGGGAGAAAGATAGG + Intergenic
1128334766 15:66778897-66778919 GAGTATGCTGGGAGACAGGACGG - Intronic
1128534766 15:68482081-68482103 GAGGCTGGTGGGGGACCGGGGGG + Intergenic
1129113537 15:73352334-73352356 GAGGCTTGTGGAAGCCTGGTGGG - Intronic
1129207106 15:74043907-74043929 GAGGCTGATAGAAGACAGGAGGG + Intronic
1129872228 15:78947860-78947882 GAGGCTGGTGGGGGGGAGGCGGG - Intronic
1130046022 15:80445580-80445602 GAGGTGGGTGGGAGACAGGATGG + Intronic
1130403316 15:83577279-83577301 GTGGCTTGTGGGCCACAGGTTGG + Intronic
1131578271 15:93614042-93614064 GAGGGAGGTGGGAGAGAGGGCGG + Intergenic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1132064052 15:98715846-98715868 GAGGCTGGTGGGTGGGAGATGGG + Intronic
1132312665 15:100868543-100868565 TAAGATGGAGGGAGACAGGTGGG + Intergenic
1132563415 16:609330-609352 GGGGATGGTGGGGGACAGGGTGG + Intronic
1132756738 16:1488928-1488950 GCGGCTGGAGGGAGACTGCTGGG - Intronic
1132905105 16:2278462-2278484 GAGGCAGGAGGGTGCCAGGTGGG + Intronic
1133457766 16:5957944-5957966 GAGGATGGTGGGGGGAAGGTGGG - Intergenic
1133652881 16:7829593-7829615 GAGGAAGGTGGGTGGCAGGTCGG - Intergenic
1133769065 16:8857181-8857203 TATGCTTGTGGGAGACAGGGTGG - Intronic
1133795073 16:9039471-9039493 AAGTCTGGTGAGATACAGGTTGG - Intergenic
1134686566 16:16162988-16163010 GCGACTGGTGGCTGACAGGTAGG - Exonic
1134700773 16:16263335-16263357 GAGGCTTCTTGGAGTCAGGTGGG + Intronic
1135304995 16:21360210-21360232 GAGGCTGGTGAGTGCCACGTGGG - Intergenic
1135746892 16:25024930-25024952 GAGGATGGTGGGATACAGGAAGG - Intergenic
1136138573 16:28274045-28274067 GGGGCTGGCGGGAGAGAGGGAGG + Intergenic
1136170723 16:28487631-28487653 GAGGGTAGTGGGAGGCAGGGTGG - Intronic
1136233925 16:28903238-28903260 GAGGCTGGTGGGAGTGGGCTGGG + Intronic
1136236912 16:28919940-28919962 GAGTCTGGTGGGGGAGAGGGAGG + Exonic
1136301741 16:29339403-29339425 GAGGCTGGTGAGTGTCAGGTGGG - Intergenic
1136370158 16:29831105-29831127 AAGGCAGGTGGAGGACAGGTAGG - Intronic
1136390805 16:29963091-29963113 GAGCCTGCTGGAAGACAGGGAGG - Exonic
1138317977 16:56086767-56086789 GAGGCTGGTGTGTGGCAAGTGGG + Intergenic
1138554618 16:57764252-57764274 GAGGGTGGTGGGAGGGAGGCTGG + Intronic
1138606889 16:58095325-58095347 GGGGGTGGTGGCAGACAGCTGGG + Intergenic
1138998216 16:62478102-62478124 GACGGTGGTGGGAGACAGACAGG + Intergenic
1139510258 16:67424134-67424156 GGGGCTGGTGGGGGAGAGGCGGG - Intergenic
1139656216 16:68388600-68388622 GCAGCTGGTGGGGGACAGTTTGG - Intronic
1140326186 16:74005508-74005530 GATGCTGGTGGCAGGCAGGCTGG + Intergenic
1140858785 16:79001215-79001237 GAGGCCGGTTAGAGACAGGCTGG + Intronic
1141109697 16:81262144-81262166 GGGGATGGTGTGAGACAAGTAGG - Exonic
1141529175 16:84634353-84634375 GAGGCCGGCAGGAGAGAGGTTGG - Intergenic
1141552451 16:84815227-84815249 GTGGCTGTTGGAAGTCAGGTTGG + Intergenic
1142063431 16:88045962-88045984 GAGGCTGGTGAGTGCCAGGTGGG - Intronic
1142202927 16:88769766-88769788 GAGCGTGGTGGGAAACAGGGAGG + Intronic
1142261215 16:89043310-89043332 GAGGGTGGTGGCAGACAGAGAGG - Intergenic
1142418187 16:89954380-89954402 GGTGCTGGTGGGAGTCAGGGTGG + Intronic
1142449482 16:90166680-90166702 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1142457610 17:65169-65191 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1142608932 17:1097125-1097147 GAGGCTCGTGGGTGGCAGGTGGG + Intronic
1142866880 17:2796565-2796587 TCGGATGGTGGGTGACAGGTGGG + Exonic
1143149276 17:4797384-4797406 GATGGAGGTGGAAGACAGGTGGG + Intronic
1143712601 17:8744760-8744782 GAAGGTGGCTGGAGACAGGTTGG + Exonic
1143830579 17:9647270-9647292 GAGGCAGGAGGGAGGAAGGTGGG - Intronic
1144843332 17:18202356-18202378 GGGGCTGGTGGAAGATGGGTGGG + Intronic
1144922122 17:18772744-18772766 GGGGGTGGTGGGAGACGGGGAGG + Intronic
1145272910 17:21414102-21414124 GAGGGTGGTGGGACCCAGCTTGG + Intronic
1145311113 17:21701538-21701560 GAGGGTGGTGGGACCCAGCTTGG + Intronic
1145786484 17:27597203-27597225 GTGGCTGGTGGGAGGCAGGTGGG + Intronic
1146527285 17:33577794-33577816 GATGGTGGTGTAAGACAGGTTGG - Intronic
1147166533 17:38596393-38596415 GACACTGGTGGGAGACAGACAGG + Intronic
1147425723 17:40345122-40345144 GAGATTGGTGGGAGACAGATGGG - Intronic
1147671546 17:42179846-42179868 GGAGCTGGAGGGAGACAGCTCGG - Intronic
1147788085 17:42994634-42994656 AAGGCTGCAGGGAGACAGGCCGG + Intergenic
1147817005 17:43217510-43217532 GAAGCTGCTGGAAAACAGGTGGG + Intronic
1148159399 17:45441499-45441521 CAGGCTGGGGGGACACAGGTTGG + Intronic
1148228929 17:45919216-45919238 GAGGCCGAGGGGAGGCAGGTAGG - Intronic
1148240352 17:45996270-45996292 TAGGCAGGTGGAAGCCAGGTTGG - Intronic
1148693378 17:49545501-49545523 GAGGCCCGGGGGAGACAGGATGG + Intergenic
1148716857 17:49722176-49722198 GAGACTGGAGGAAGACAGGGAGG - Intronic
1149181963 17:53950563-53950585 GAGGCTGTTGGGACACAAGACGG - Intergenic
1149580275 17:57745136-57745158 GCGGGTGGTGGGAGGCAGGAGGG + Exonic
1149993330 17:61394713-61394735 GAGGCCGGTGGGAGCCAGCGTGG + Intergenic
1150390734 17:64788584-64788606 CGGGCTGGGGGGACACAGGTTGG + Intergenic
1151786141 17:76275944-76275966 GAGCCTGATGGGGGACAGGAGGG + Exonic
1151893285 17:76963769-76963791 GAAGCCGGTGGGAGAGAGATGGG - Intergenic
1151956790 17:77384134-77384156 GAGGCTGGCGGGAGGCTGGCTGG + Intronic
1152462395 17:80448443-80448465 GAAGCTGTTGGGGGGCAGGTGGG + Intergenic
1152495350 17:80667240-80667262 GAGGCTGGAGGGGGACAGCCGGG + Intronic
1152806124 17:82357208-82357230 GAGGCTGGGAGGGGCCAGGTGGG + Intergenic
1153055270 18:939641-939663 AAGTTTGGTGGGAGACAGGGAGG + Intergenic
1154177549 18:12094717-12094739 GAGTTGGGTGGGAGACTGGTGGG + Intronic
1154954811 18:21242860-21242882 CAGGCGGGCGGGCGACAGGTAGG + Intronic
1155520852 18:26667628-26667650 GAGGAAGGAGGGAGACAGGGAGG + Intergenic
1156067866 18:33166921-33166943 GAGGGTGGAGGGAGGCAGGAGGG - Intronic
1156502229 18:37566997-37567019 GTGGCTGGCGGGAGGAAGGTAGG + Intergenic
1156518614 18:37702159-37702181 GAGGCTGGTGGCAGACAGGAAGG + Intergenic
1156535092 18:37855127-37855149 GAGGCGGGTTGGGGAAAGGTAGG - Intergenic
1158121051 18:54048898-54048920 GAAGCTGGTTGGAGACAGCTGGG - Intergenic
1158413709 18:57231146-57231168 CATGCTGGTGGGGGACAGGTGGG + Intergenic
1158488844 18:57892196-57892218 GAGGCTGGGAGGAGAGAGGGGGG - Intergenic
1158847303 18:61458172-61458194 GAGGATGGAGGGACACAGGAAGG - Intronic
1159903220 18:74067071-74067093 CAGGATGATGGGAGTCAGGTGGG + Intergenic
1160031965 18:75269816-75269838 GTGGCTGCTGGGAGCCAGGGGGG - Intronic
1160044859 18:75377066-75377088 GAGGCTGGAGGGACAAAGGAAGG - Intergenic
1160317319 18:77859768-77859790 GAGGCTGGAGGGAGGCAGGTAGG + Intergenic
1160588020 18:79923276-79923298 CAGGCGGGTGGTGGACAGGTGGG + Intronic
1160589291 18:79933713-79933735 GAAGCAGGAGGGAGACAGGAAGG - Intronic
1160671827 19:368795-368817 GAGGCTGGAGGGAGCCAGGGAGG - Intronic
1160680395 19:409328-409350 GGGGCCGGTGGGAGACAAGCAGG + Intergenic
1160758790 19:772125-772147 GAGGAAGGGGGGAGACAGGGAGG - Intergenic
1160823365 19:1068230-1068252 GAGGATGTTGGGTAACAGGTGGG + Intronic
1160980880 19:1816041-1816063 GAGGCGGGTGGGAGGCGGGCAGG + Exonic
1161008880 19:1950583-1950605 GAGGCCTCTGGGAGACAGGAGGG + Intronic
1161335155 19:3708935-3708957 GAGGCTAGGAGGTGACAGGTGGG + Intronic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161508583 19:4657790-4657812 GAAGCTGTTGGGAGCCAGGAGGG + Exonic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161623173 19:5309955-5309977 GAGGGAGGTGGGAGCCAGGGAGG - Intronic
1161649960 19:5478264-5478286 GAGGCAGCTGGGACAGAGGTGGG + Intergenic
1162563339 19:11430838-11430860 GTGGATGGTGGGGGACAAGTAGG - Intronic
1162630459 19:11923563-11923585 CAGGCTGGTGGGAGAGAGGGTGG - Intergenic
1163311566 19:16518156-16518178 GAAGCTGGTGGGTGACCGTTGGG - Exonic
1163699344 19:18779433-18779455 GAGGCTGGGGGCAGACAGCGGGG + Exonic
1164730967 19:30504302-30504324 GAGGCTGGTGGGAGGGAGGAAGG - Intronic
1164870701 19:31640575-31640597 GACGCTGGAGGGAGAGAAGTGGG + Intergenic
1165148806 19:33749362-33749384 GAGGATGGTGGGTGGCTGGTGGG - Intronic
1165149644 19:33753410-33753432 GTGGGTGGTGGGAGGAAGGTGGG - Intronic
1166148449 19:40852872-40852894 GGGGATGGGGAGAGACAGGTTGG + Intronic
1166152590 19:40884657-40884679 GGGGATGGGGAGAGACAGGTTGG + Intronic
1166979116 19:46622278-46622300 GAGGCAGAGGGGAGCCAGGTAGG + Intronic
1167239054 19:48332507-48332529 GAGGTTGCCGGGAGCCAGGTTGG + Exonic
1168316283 19:55486101-55486123 GAGGCTGGAGGGAGGCTGCTGGG - Intronic
1168563500 19:57403594-57403616 GGGGCTGGTGGAAGGCAGGAGGG - Intronic
925017646 2:543799-543821 GGGGAGGGTGGGAGACAGGCAGG + Intergenic
925390458 2:3490559-3490581 AAGGATGGAGGCAGACAGGTGGG - Intergenic
925662078 2:6213262-6213284 GAGGCTGGTGGGAGCTTGCTGGG - Intergenic
925856452 2:8134073-8134095 GAAGCTGGCGGGAGGCAGGAGGG - Intergenic
925862596 2:8194463-8194485 GAGGATGGTGGGAGGAAGGAAGG - Intergenic
925898724 2:8493567-8493589 GAGGTGGGAGGGAGACGGGTTGG + Intergenic
926076982 2:9950503-9950525 GTGGCTGGTGGGGCACAGGGAGG - Intergenic
926092763 2:10061326-10061348 GAGGATGGTGGGAAACAGGAAGG - Intronic
926165661 2:10521142-10521164 GAGGCTGGAGGGAGGGAGGGAGG + Intergenic
926347118 2:11957574-11957596 GAGGGAGGCTGGAGACAGGTAGG + Intergenic
926731559 2:16039418-16039440 GAGGAGGGAGGGAGACAGGGAGG - Intergenic
926731566 2:16039437-16039459 GAGGAGGGAGGGAGACAGGGAGG - Intergenic
927199668 2:20570560-20570582 CAGGATGGTGGGAGAGAGATGGG + Intronic
927482088 2:23462096-23462118 GAGGCAGGTGACTGACAGGTGGG + Intronic
927874909 2:26648784-26648806 GGGGCTGGGGAGAGAGAGGTGGG - Intergenic
927889361 2:26738743-26738765 GAGGTTGCTGGGAGGCAGGGAGG + Intergenic
928167445 2:28981399-28981421 GTGGCTGGTGGGGGCCAGGGTGG + Exonic
928200718 2:29246177-29246199 GATGCTGGTCCTAGACAGGTAGG + Intronic
928264489 2:29800182-29800204 GAGGCTGAAGAGTGACAGGTGGG + Intronic
928368694 2:30723107-30723129 CAGGCTGTTGGGAGACAGCTTGG + Exonic
929242347 2:39665855-39665877 GAGGGAGGTGGGGGGCAGGTGGG + Intronic
930355419 2:50312586-50312608 GAGCCTGGAGAGAGAGAGGTTGG - Intronic
931214090 2:60225578-60225600 GAGGCTGGTGGGCCACATGCAGG - Intergenic
931763660 2:65436476-65436498 GGGGCTTGGGGGAGACAGCTGGG - Intergenic
932135767 2:69227317-69227339 GAGGCTTCTGGGAGCCAGCTGGG + Intronic
932564671 2:72898376-72898398 CAGGCTGGTGGGGGAGAGGGTGG + Intergenic
933136387 2:78741098-78741120 GAGGCAGGTGGGTTACAGCTTGG + Intergenic
933351076 2:81152811-81152833 GAGGCTGCTCGGAGAGAGTTCGG - Intergenic
933898120 2:86829465-86829487 CAGGCTGGGGGGAGTCAGGCGGG + Intronic
935172263 2:100619631-100619653 GAGGGTGGTGAGAGCCAGGTTGG + Intergenic
935213280 2:100956355-100956377 GAGGCTGGAGGGAGGAAGGAAGG - Intronic
936080416 2:109429102-109429124 GAGGTGGGAGGGAGGCAGGTTGG + Intronic
936083208 2:109449245-109449267 GAGGCTGGTGGCAGGCAGGCGGG - Exonic
936932178 2:117801433-117801455 GAGTCTGGAAGGTGACAGGTGGG + Intergenic
937230912 2:120397653-120397675 GCAGCTTGTGGGAGGCAGGTGGG - Intergenic
937390848 2:121485056-121485078 GAGGGTGGTGAGAGACATTTTGG + Intronic
937457584 2:122055782-122055804 GGGGCTGGTGGGGGAAAGGAGGG - Intergenic
937855031 2:126666105-126666127 GCAGCTGCTGGGACACAGGTGGG - Intronic
937911025 2:127075748-127075770 GAGGGTGGTGGGGGGCAGCTGGG - Intronic
939532515 2:143382145-143382167 GAGGCTGGTGGAAGGAAGGGAGG - Intronic
940207039 2:151214264-151214286 GAGGCTGGTGGGAGGCAGGTGGG + Intergenic
940628661 2:156209582-156209604 GAGGGTGGAGGGTGACAGGAAGG - Intergenic
942838721 2:180334013-180334035 GAAGGTAGTGGGTGACAGGTGGG + Intergenic
942951666 2:181728810-181728832 GAGGCTGATGGGAGCCATGGAGG - Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
945020291 2:205564203-205564225 TAGGCTGGTTGTAAACAGGTAGG + Intronic
945923388 2:215778934-215778956 GAGACAGGTGGGAGGCAGGCAGG - Intergenic
946146638 2:217735962-217735984 TAATCTGGTGGGAGACAGATTGG + Intronic
946149538 2:217754981-217755003 GATGCTGGTGAGAGAGAGGATGG - Intronic
946216480 2:218187617-218187639 TGGGCAGATGGGAGACAGGTGGG + Intergenic
946228889 2:218279554-218279576 GAGGCTGGTGTTGGACAGGAGGG - Intronic
946663019 2:222020984-222021006 GGTGCTGGTGGGATATAGGTGGG - Intergenic
946877086 2:224140101-224140123 GAGGCTGGAGGGTGAGAGGAGGG - Intergenic
947383376 2:229566666-229566688 GAGCCTGATGGGAGAGAGGCTGG - Intronic
947434739 2:230063402-230063424 GAGGCTGGAAGGAGAGAGGAGGG - Intronic
947536833 2:230945038-230945060 GAGGCTGGTGGGAGGAAGGAAGG - Intronic
947826263 2:233107804-233107826 GCGGGTGGTTGGAGACAGGGTGG + Intronic
947969787 2:234313387-234313409 GTCGCTGGTGGGAGAAAGGAAGG - Intergenic
948880657 2:240855693-240855715 CAGTTTGGTGGGGGACAGGTCGG + Intergenic
948954185 2:241273797-241273819 GAGGATGGTGGGAGCTGGGTGGG + Intronic
948963749 2:241360010-241360032 GCAGCTGGAGGGAGACAGGGAGG - Intronic
949079775 2:242087991-242088013 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
1168892041 20:1300913-1300935 GAGGCTGTTGGGGGCCAGGCGGG + Intronic
1170234330 20:14085034-14085056 GGGGGTGGTGGGGGAGAGGTGGG + Intronic
1170831362 20:19844524-19844546 ATGGCTGGTGTGTGACAGGTGGG + Intergenic
1170912977 20:20593218-20593240 GATGCTGGTGGGAAACTGTTTGG + Intronic
1171164367 20:22957332-22957354 GAGTCTGTTTGGAGACATGTGGG - Intergenic
1171509937 20:25673962-25673984 TTGGCTGGTGGGGCACAGGTAGG - Intergenic
1171780001 20:29409897-29409919 GAGGCTGGCAGGACACGGGTTGG + Intergenic
1171823982 20:29878179-29878201 GAGGCTGACGGGAGAAGGGTTGG + Intergenic
1171896089 20:30812156-30812178 GAGGCTGATGGGACAGGGGTTGG - Intergenic
1172045511 20:32077329-32077351 GTGGCTGGTTGGGGACAGGGTGG - Intronic
1172110957 20:32544598-32544620 GAGGCTGGAAGGAGAGAGGCAGG + Intronic
1172149458 20:32779957-32779979 GAGGCTGGCGGCAGACGGGCCGG + Intronic
1172445936 20:34993453-34993475 GCGCCTGCTGGGAGGCAGGTGGG + Exonic
1172457764 20:35091516-35091538 GTGGTTGGTGGGAGTGAGGTGGG - Intronic
1172531002 20:35631423-35631445 GAAGCTTGTGGGAGAGAGGAAGG - Intronic
1172995765 20:39069446-39069468 GAGGGTGGTGGGACTGAGGTGGG + Intergenic
1173111363 20:40193435-40193457 GAGGATAGAGGGAGACAGGAAGG - Intergenic
1174174273 20:48635261-48635283 GAAGCTGGAGGGAGATGGGTGGG - Intronic
1174392168 20:50224381-50224403 GGGGGTGGTGGGGGACAGGAGGG + Intergenic
1175011061 20:55736531-55736553 GAGGGTGGAGGGAGGCAGGAGGG + Intergenic
1175173099 20:57093335-57093357 GAGGCTGGTGGGAGGGTGGGTGG + Intergenic
1175430463 20:58898672-58898694 GACTCTGGTCGGAGACAGGAGGG - Intronic
1175946227 20:62560117-62560139 CAGGCTGGGGGGAGGCAGGGCGG - Intronic
1176115375 20:63429778-63429800 GAGGCTGGTGGGGTGCAGGGAGG - Intronic
1176373621 21:6076761-6076783 CAGGGGGCTGGGAGACAGGTGGG + Intergenic
1178422107 21:32451290-32451312 GAGGTGTGTGGGAGACAGCTTGG - Intronic
1178431261 21:32520573-32520595 AAGGCTGGGGGGAGACTGGAAGG - Intergenic
1178727012 21:35062120-35062142 GAGGGTGAAGGGAGACAGGGAGG - Intronic
1178810152 21:35874169-35874191 GACGCTGGAGTAAGACAGGTGGG - Intronic
1179255073 21:39708784-39708806 GAGGATGCTGGGTGGCAGGTGGG + Intergenic
1179303454 21:40133838-40133860 GAGGATGGTGAGAGACGGGTGGG - Exonic
1179348389 21:40583498-40583520 GAGGGTGGGAAGAGACAGGTGGG - Intronic
1179645026 21:42770441-42770463 GATGAGGGTGGGGGACAGGTTGG - Intronic
1179749856 21:43461482-43461504 CAGGGGGCTGGGAGACAGGTGGG - Intergenic
1179788689 21:43743451-43743473 GGGGCTGGGGGGAGGGAGGTGGG - Intronic
1179788707 21:43743502-43743524 GGGGCTGGGGGGAGGGAGGTGGG - Intronic
1179788844 21:43744026-43744048 GTGGCTGGTGTGAGACAGGAAGG + Intronic
1179982917 21:44905792-44905814 GAGGCAGCTGGGAGACAGTGAGG - Intronic
1180059003 21:45375169-45375191 GAGGCTGGTGGGTGACTTGCTGG + Intergenic
1180186803 21:46144405-46144427 GAGGGAGGGGGGAGAGAGGTAGG - Intronic
1180911999 22:19457292-19457314 GAGGGGGCTGGGAGACAGCTGGG - Intronic
1181061584 22:20284471-20284493 GGGGCTGGTGAGAGCCCGGTGGG + Intergenic
1181319061 22:21990803-21990825 GGGGCTGTTGGGAGACTGGAAGG - Intergenic
1181494488 22:23280308-23280330 CAGGCTGGTGGGAGTGAGGAGGG - Intronic
1181531690 22:23520998-23521020 GTGGCTGGTGGGAGTCAGTGGGG - Intergenic
1181603557 22:23966628-23966650 GAGGGTCGGGGGAGACAGGGTGG + Intergenic
1181604956 22:23974679-23974701 GAGGGTCGGGGGAGACAGGGTGG - Intronic
1181646800 22:24235781-24235803 TAGGCTGGAAGCAGACAGGTTGG - Intronic
1181672080 22:24430379-24430401 GAGGCTGGTGGGCAGCAGGAAGG + Intronic
1181998413 22:26901490-26901512 CAGGCTGGTGGGGGACTGGGAGG + Intergenic
1182051549 22:27316302-27316324 GAGGGAGCTGGGACACAGGTCGG - Intergenic
1182905278 22:33930747-33930769 GAGGCTGATGATAGACAGGTAGG - Intergenic
1183075790 22:35426051-35426073 GAGGCAGGTGCCAGTCAGGTGGG + Intergenic
1183160688 22:36110986-36111008 GAGGCTGCAGTGAGACAGGATGG - Intergenic
1183675508 22:39296991-39297013 GGGGCTGGTGGGGAACAGGCGGG + Intergenic
1183949308 22:41343783-41343805 GAGGCAGGTGGGACACATTTGGG + Intronic
1184145904 22:42610388-42610410 GAGGTTGTTGGGGGACAGGGTGG - Intronic
1184195616 22:42925803-42925825 GAGGCCGGTGGTAGACAGGCAGG - Intronic
1184429186 22:44431322-44431344 GACGCTGGTGTGAGCCTGGTTGG + Intergenic
1184635448 22:45825100-45825122 GCAGCTTGTGGGAGCCAGGTAGG + Intronic
1184987572 22:48146030-48146052 GAGGCAGGAGGGAGGCAGGAAGG - Intergenic
1184995997 22:48208070-48208092 GAGGCTGGTGTGACGCAGGCAGG - Intergenic
1185014046 22:48333242-48333264 GAGGCTGGAGGGAGGCGGGTTGG - Intergenic
1185231785 22:49687893-49687915 AGGGCTGGTGGGAGACGGTTGGG - Intergenic
1185332251 22:50257044-50257066 GAGGCTGCAGGGAGGCAGGCAGG - Intronic
949443336 3:4107567-4107589 TAGGTGGGTAGGAGACAGGTGGG - Intronic
949531162 3:4956930-4956952 AAGGCTGTGGGGAGAGAGGTTGG - Intergenic
950222185 3:11204924-11204946 GGGGCTGGAGGGAGCCTGGTTGG - Intronic
951019448 3:17766663-17766685 GAGCCTGGTGGCAAACAGGCTGG - Intronic
952489687 3:33855973-33855995 GAGGTGGGTGGCAGACAGGCGGG + Intronic
952820768 3:37483752-37483774 GGAGCTGGGGGGAGACAGGTGGG + Intronic
952858775 3:37794991-37795013 GAGGGAGGAGGGAGACAGGGTGG - Intronic
953571937 3:44078176-44078198 GGGGCTGGAGGGAGGCAGTTAGG - Intergenic
953919940 3:46944747-46944769 GAGACTTAGGGGAGACAGGTTGG - Intronic
954665473 3:52249119-52249141 GAGGCTGGTGGGAGTCGGGAAGG + Intronic
955064907 3:55525813-55525835 GAAGCTGGGTGGAGGCAGGTGGG + Intronic
955645976 3:61137847-61137869 GAGGCTGCAGGGAGAGAGGTGGG - Intronic
955799084 3:62667794-62667816 GGGGGTGGGGGGAGACAGGGAGG + Intronic
956169218 3:66419546-66419568 GAGGCCAGGAGGAGACAGGTAGG + Intronic
956169258 3:66419784-66419806 GAAGTTGGGAGGAGACAGGTGGG - Intronic
956942613 3:74181090-74181112 GAGGGTGGAGGGTGAGAGGTGGG + Intergenic
957048522 3:75394754-75394776 GAGGTGTGTGGGAGACAGCTTGG + Intergenic
957085107 3:75670604-75670626 GAGGCTGGTGGGACACGGGTTGG - Intergenic
959015292 3:101127156-101127178 GAGGGAGGTGGGAGACAGACAGG + Intergenic
959156488 3:102672915-102672937 GAAGCTTGTGGGAGGCAGATAGG - Intergenic
959295555 3:104530684-104530706 GAAGCTGTTGGGAGCCAGGAAGG - Intergenic
960257494 3:115526547-115526569 GAGGGTGGAGGGTGACAGGAGGG - Intergenic
960658135 3:120028750-120028772 GAGGCTGGGCAGAGAGAGGTTGG + Intronic
961216628 3:125165115-125165137 GATGATGGTGGGAGGGAGGTGGG - Intronic
961319207 3:126061358-126061380 GAGGCTGCTTGGAGACAGTGTGG - Intronic
961321241 3:126078034-126078056 CAGGGAGGTGGGAGGCAGGTGGG - Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961645201 3:128389126-128389148 GAGGCTGGAGGGAGGCAGGCAGG + Intronic
961754404 3:129119551-129119573 GAGGCTGTTGGGAATCAGCTGGG - Intronic
961880601 3:130058867-130058889 GAGGTGTGTGGGAGACAGCTTGG + Intergenic
962139694 3:132776114-132776136 GTGGGGGGTGGGAGAGAGGTGGG + Intergenic
962887057 3:139637585-139637607 AAGGTGGGTGGGAGACAAGTAGG - Intronic
964194891 3:154052012-154052034 GAGGCTGCTGGGACAGAAGTTGG + Intergenic
965457800 3:168925496-168925518 GAAGAAGGTGGGAGTCAGGTGGG + Intergenic
965881584 3:173395143-173395165 GAGGCTAGTGGGAAGCGGGTAGG + Intergenic
966484705 3:180454809-180454831 GCGTCTGGTGGAAGACAGCTAGG - Intergenic
966790793 3:183667593-183667615 GGGGCTGGTGGGGGACTGGTCGG - Intronic
967429165 3:189361687-189361709 GGGGCTGGGGGGTGAAAGGTTGG - Intergenic
967806097 3:193715758-193715780 GGGCCTGGTGGGAGATAGTTGGG + Intergenic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968992991 4:3927211-3927233 GAGGTGTGTGGGAGACAGCTTGG + Intergenic
969247416 4:5944710-5944732 CAGCCTGCTGGGAGACAGGCAGG + Intronic
969429299 4:7144961-7144983 GGGGCTGAGGGGAGCCAGGTGGG - Intergenic
969822482 4:9731151-9731173 GAGGTGTGTGGGAGACAGCTTGG - Intergenic
969858913 4:10020809-10020831 GAGGCTGGTGAAGGGCAGGTGGG + Intronic
969973617 4:11074091-11074113 GAGCATGGAGGGAGAGAGGTTGG - Intergenic
971142904 4:23944398-23944420 GAAGCTGGAGGGAGACAAGAAGG - Intergenic
972296622 4:37745475-37745497 GGGGCTGGTGGGCAACTGGTAGG - Intergenic
972338520 4:38129925-38129947 GTGGCTGTTGGGAGACAATTTGG + Intronic
972543233 4:40057037-40057059 GCGGCGGGTGGGAGGCAGGGAGG + Intronic
972726908 4:41752417-41752439 GAGGCGGGTGGGTAACAGGATGG + Intergenic
973163394 4:47046990-47047012 GAGGCTGGAGGGTGGCAGGAGGG + Intronic
973362555 4:49178450-49178472 GAAGCTGGTGGGAGCCAGGAAGG - Intergenic
973895652 4:55410075-55410097 AAGGCTGGTGGGAGGCAAGGAGG - Intronic
974907859 4:68079376-68079398 AAAGTTGGTGGGAGACAGGCAGG + Intronic
975900124 4:79141413-79141435 GATGCTGGTGGGAGGCACTTGGG + Intergenic
977270721 4:94914648-94914670 GAGGCTGGGAGGAGAAAGGGTGG + Intronic
977669574 4:99680325-99680347 CATGCTGGTGGGAGAGATGTGGG + Intergenic
977778299 4:100949801-100949823 GAGGATGATGGTAGACAGGAGGG + Intergenic
978488620 4:109285982-109286004 GAGGCTGGTGGAATAGAAGTAGG + Intronic
978490019 4:109302492-109302514 AATGCAGGTGGGAAACAGGTCGG - Exonic
978637109 4:110822760-110822782 GAAGCTTGGGGGAGACAGCTGGG + Intergenic
979258826 4:118630985-118631007 TAGGCTGCTGGGAGACACGCAGG - Intergenic
979329523 4:119409572-119409594 TAGGCTGCTGGGAGACACGCAGG + Intergenic
980875643 4:138659421-138659443 GAAGCAGGAGGGAGACAGGCGGG + Intergenic
981537677 4:145816625-145816647 TAGGCTGGTGGGGGACAGATGGG + Intronic
981616393 4:146648377-146648399 GAAGGTGGTGGGAGAAAGTTGGG + Intergenic
981714227 4:147737025-147737047 GATGCTGTTGGGAGACCTGTGGG + Intronic
983497828 4:168463441-168463463 GAGGGTGGAGGGTGAGAGGTGGG + Intronic
983767266 4:171499795-171499817 GAGGCTTGTGCCAGACATGTTGG - Intergenic
984530936 4:180915440-180915462 GAGCCTGGTGGAAGACATGTGGG - Intergenic
984762760 4:183376825-183376847 GAGGGGGGTGGCAGAGAGGTGGG - Intergenic
984870677 4:184322332-184322354 GAGGGTGGAGGGAGAGAGGAGGG - Intergenic
985393352 4:189514898-189514920 GGGGATGGTGGGGGGCAGGTGGG - Intergenic
985966757 5:3343629-3343651 AAGGGTGGGGGGAGAGAGGTGGG - Intergenic
986285297 5:6354490-6354512 GAGGCTGGAGGGAGACAGGCTGG + Intergenic
986285321 5:6354587-6354609 GAGGCTGGGGAGAGACAGGCTGG + Intergenic
986285335 5:6354636-6354658 GAGGCTAGGGAGAGACAGGCTGG + Intergenic
986285349 5:6354684-6354706 GAGGCTGGGGAGAGACAGGCTGG + Intergenic
986749813 5:10776825-10776847 GAGGCTGGTGGGAATGAGGAAGG - Intergenic
986888319 5:12267833-12267855 GAGGCTGGAGGGTGAGAGGAAGG - Intergenic
986974954 5:13383063-13383085 CAGGGTGGTGGGACACAGCTGGG - Intergenic
987159222 5:15123511-15123533 GAGGCTGGTTGGAGCCAGAGTGG - Intergenic
987300938 5:16597707-16597729 GGGGCATGTGGGAGACATGTTGG - Intronic
988318102 5:29657811-29657833 GAGGGTGGAGGGAGAGAGGAGGG + Intergenic
988545928 5:32157281-32157303 GAGACTGGTGGGAAAAAGGGAGG - Intronic
988574357 5:32405726-32405748 GAGGCAGGTGTGGCACAGGTAGG - Intronic
989459857 5:41684829-41684851 CAGGGTGGTGGGAGAGGGGTTGG - Intergenic
990362583 5:55035683-55035705 GAGCATGGTGGGAGATTGGTGGG + Intergenic
990783184 5:59389840-59389862 GAGGCTGGGAAGAGAGAGGTGGG + Intronic
991477652 5:67040464-67040486 CAGGCTCATGGTAGACAGGTGGG - Intronic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
993014680 5:82522031-82522053 GAGGCTGATGGGAGATTGGAGGG + Intergenic
993313398 5:86367605-86367627 GAGGCTGCTGGAAGAAATGTGGG + Intergenic
994085300 5:95751678-95751700 GAGGGTGGTGGGAGGGAGGAGGG - Intronic
994215081 5:97128879-97128901 GAGGCTGGTTGGAGTCAGGAGGG - Intronic
996969957 5:129353917-129353939 AAGGATGGTGGGGGAGAGGTGGG + Intergenic
997197014 5:131987140-131987162 GAGGCTCCTGGGAGACAGGGAGG + Intronic
997459603 5:134042958-134042980 GTGGGTCGTGGGAGACAGGCTGG + Intergenic
998018417 5:138751259-138751281 GGGGCTGGTGGGAGGCATTTGGG - Intronic
998207025 5:140165276-140165298 GAGAATGGTGGGGGACAGGGTGG + Intergenic
999665854 5:153912239-153912261 GAGGATGGTGGGTGAGAGGAGGG - Intergenic
1000112070 5:158117747-158117769 GAGGGTGACAGGAGACAGGTTGG + Intergenic
1000407068 5:160899380-160899402 AAGGCTTTTGGGAGACAGGGTGG + Intergenic
1001131755 5:169069978-169070000 GAGGATGGTGGGATGCAGATAGG + Intronic
1001245263 5:170101363-170101385 GAGGCAGGTGGGAGCCAGCCTGG - Intergenic
1001554408 5:172626177-172626199 GAGGATGGTGGCAGATGGGTGGG + Intergenic
1001558078 5:172649791-172649813 GAGGCTGGGTGGACACAGGGAGG - Intronic
1001657810 5:173366208-173366230 GAGGCTGGAGGGTGAAAGGAGGG - Intergenic
1001734648 5:173988760-173988782 GGGGCTGGAGGGAGAAAGCTGGG - Intronic
1001868142 5:175123646-175123668 GAGGCATGTGGGAGAGAGGTGGG + Intergenic
1002195088 5:177497089-177497111 GAGGCTGCTGGGAGCCAGGGCGG + Intronic
1002258890 5:177980937-177980959 GAGGCTGGTGGAAGCCAGACTGG + Intergenic
1002424666 5:179168008-179168030 GAGGCTGGTCTGAGGCAGGAGGG - Intronic
1002698475 5:181105809-181105831 GGGACTGGAGGGAGAGAGGTGGG - Intergenic
1002708425 5:181179107-181179129 GGGACTGGAGGGAGAGAGGTGGG + Intergenic
1002729405 5:181324598-181324620 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1002794690 6:463122-463144 AAGGGTGGTGGGAGGCAGGGAGG + Intergenic
1002805860 6:573387-573409 GAGGCAGGTGGGAGGCAGCAGGG - Intronic
1002878524 6:1232514-1232536 GAGGCGGGTGGGTGACATGTGGG - Intergenic
1003094721 6:3133289-3133311 GAGGCTGGCGGGAGCCTGGTGGG - Intronic
1003209915 6:4053442-4053464 GAGGCTGGAGGGTGAGAGATGGG - Intronic
1005260861 6:24057849-24057871 GAGGCTGAGTGGGGACAGGTAGG - Intergenic
1005401472 6:25438751-25438773 GAGCCTCGTGGGAAAGAGGTTGG + Intronic
1005574097 6:27176074-27176096 GTGCGTGGTGGGAGACAGGAGGG - Intergenic
1006025347 6:31143246-31143268 CATGCTGGTAGGAGACAGGAGGG - Exonic
1006153530 6:32001887-32001909 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006159838 6:32034624-32034646 AGGGCTGGGGGGAGACAGGGAGG + Intronic
1006294302 6:33163156-33163178 GAGGAAGGTGGGAGGGAGGTGGG + Exonic
1006374352 6:33663637-33663659 TGGGCTGGAGGGAGACAGATGGG + Intronic
1006401612 6:33821068-33821090 GAGGGAGGTGGGAGAGAGATGGG + Intergenic
1006409013 6:33861546-33861568 GTTGCAGGTGGAAGACAGGTTGG + Intergenic
1006641786 6:35493011-35493033 GTGGCTGGTGGGAGCCCAGTGGG - Intronic
1007257806 6:40540928-40540950 GAGGCTGCTGGGGGTCAGGAGGG + Intronic
1007712827 6:43835581-43835603 GAGGCAGCTGGTATACAGGTGGG - Intergenic
1008667934 6:53735213-53735235 GAGGGAAGTGGGAGACAGGAAGG - Intergenic
1010329673 6:74608531-74608553 GAGGCTGGAGGGTGAGAGGAGGG - Intergenic
1011014773 6:82742845-82742867 GGGGCTGGTTGGAGTCAGGAGGG - Intergenic
1011119940 6:83941623-83941645 GAGGATGATGGGAGACAGCAGGG - Intronic
1011504921 6:88030903-88030925 GAGGGTGGTGGGTGAGAGGAGGG + Intergenic
1011534437 6:88360802-88360824 GAGGCAGGTGGGAGACAGGGAGG - Intergenic
1012388453 6:98708808-98708830 GAGGCTGTTGAAAGCCAGGTGGG - Intergenic
1013170494 6:107633927-107633949 GTGGCTGGACGGAGACAGGAGGG - Exonic
1013616633 6:111849566-111849588 CAGGCTGGAGGGAGAAAGGTGGG + Intronic
1013849427 6:114496165-114496187 AACCCTGGTGGCAGACAGGTGGG - Intergenic
1015271931 6:131345374-131345396 AAGGATGGTGGGAGAAAGGAGGG + Intergenic
1015328825 6:131953456-131953478 GAGGTAGGTGGGAGAAGGGTTGG + Intergenic
1017822875 6:158061537-158061559 GAGGCTGGTGCGCGGCAGGATGG + Intronic
1018387910 6:163321757-163321779 GAGAGTGGCGGGAGTCAGGTGGG - Intergenic
1018539217 6:164860006-164860028 GAGGCTCGTGGCAGAAAGATAGG - Intergenic
1018836337 6:167487028-167487050 GATGCTGCATGGAGACAGGTCGG + Intergenic
1018861499 6:167713450-167713472 GAGGCTGGTGGAAGACACCTGGG + Intergenic
1019511522 7:1419916-1419938 GGAGCTGGTGGCAGCCAGGTTGG - Intergenic
1019913077 7:4113372-4113394 GACGCTGGTTGGAGCCACGTCGG - Exonic
1020106046 7:5422774-5422796 GAGCCTGATGGGAGAGAGGGAGG - Intronic
1020315629 7:6903556-6903578 GAGGTGTGTGGGAGACAGCTTGG + Intergenic
1022403965 7:30069185-30069207 GAGGCTGGTGGGAAACAGATAGG - Intronic
1022414036 7:30162889-30162911 GAGGCTGGGGGAAGAGAGGGAGG + Intergenic
1022477607 7:30722055-30722077 GAGGCTGTTTTGAGACAGGGTGG - Intronic
1022942795 7:35255825-35255847 GTGTCTGGGGAGAGACAGGTTGG - Intergenic
1023939687 7:44761611-44761633 GAGCCTCGTGGGGGTCAGGTGGG - Intronic
1024073730 7:45808035-45808057 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1024649604 7:51392165-51392187 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1024962991 7:54996973-54996995 GAGACTGGGGAGTGACAGGTGGG + Intergenic
1024983947 7:55180050-55180072 CAGGCTGGCGGGAGGCAGGGTGG - Intronic
1024987870 7:55211767-55211789 GAGGCTGGTTAGCGACAGGGGGG - Intronic
1025053685 7:55747495-55747517 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1025131788 7:56377969-56377991 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1025175966 7:56802603-56802625 GAGGCTGCCGGGAGGCAGGCAGG + Intergenic
1025178120 7:56812097-56812119 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025178550 7:56813836-56813858 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025178988 7:56815626-56815648 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025179893 7:56819350-56819372 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025180368 7:56821332-56821354 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025180811 7:56823170-56823192 CAGGCTGCTGGGAGGCAGGCAGG + Exonic
1025181238 7:56824921-56824943 CAGGCTGCTGGGAGGCAGGCAGG + Intronic
1025182584 7:56831048-56831070 TAGGCTGCTGGGAGACAGGCAGG + Intergenic
1025182665 7:56831466-56831488 GAGCCTGCTGGGAGGCAGGCAGG + Intergenic
1025182801 7:56832169-56832191 GAAGCTGCTGGGAGGCAGGCAGG + Intergenic
1025689125 7:63744805-63744827 GAGGCTGCTGGGAGGCAGGTAGG - Intergenic
1025689259 7:63745508-63745530 GAGCCTGCTGGGAGGCAGGCAGG - Intergenic
1025689342 7:63745926-63745948 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1025690231 7:63750236-63750258 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025690679 7:63752059-63752081 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025691130 7:63753882-63753904 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025691562 7:63755658-63755680 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025692004 7:63757481-63757503 CAGGCTGCTGGGAGGCAGGCAGG - Exonic
1025692453 7:63759304-63759326 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025692897 7:63761127-63761149 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025693313 7:63762806-63762828 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025693756 7:63764629-63764651 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025695827 7:63773819-63773841 GAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025912675 7:65840689-65840711 GAGGCTGCTGGGAGGCAGGCGGG - Intergenic
1026554029 7:71390746-71390768 GAGACAGCTGGGAAACAGGTGGG - Intronic
1028563857 7:92205992-92206014 GGTGCTGGTGGCAGGCAGGTGGG - Intronic
1029124892 7:98288924-98288946 TAGGCTAGAGGGAGGCAGGTGGG + Intronic
1029238279 7:99142104-99142126 GAGCCCGGGGGGAAACAGGTTGG + Intronic
1029480008 7:100806636-100806658 GAGGCAGGTGGGGGACTGGGGGG - Intronic
1030844735 7:114395040-114395062 GAGGCAAGTGGGAGTTAGGTTGG + Intronic
1032051129 7:128651734-128651756 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1032207026 7:129874966-129874988 GAGGCTGCTGGGAAACACGTGGG + Intronic
1032209602 7:129901428-129901450 GATGCTGGTGGGATAGAGGTCGG + Intronic
1032301805 7:130694527-130694549 GAGGCTAGTGGGAGATTGGAGGG + Intergenic
1032739074 7:134721058-134721080 CAGGCTGTTGGGCTACAGGTAGG - Intergenic
1033150856 7:138913937-138913959 GAGGGAGGAGGGAGACAGGAAGG + Intronic
1033243325 7:139699168-139699190 CAGGCTGGTGGGAGAGATGGCGG - Intronic
1033769054 7:144527950-144527972 GAGGCGGGTGGGAGGCGGGTGGG + Intronic
1034278447 7:149834942-149834964 GTGGCAGGTGGGAGTCAGGGAGG - Intergenic
1035259906 7:157654342-157654364 GGTGCTGGTGGGAGTCAGGGTGG - Intronic
1035537826 8:406276-406298 GCGGCTGGAGGGAGAGAGGCAGG - Intergenic
1036195969 8:6715219-6715241 TAGCCTGGTGGGTGAGAGGTAGG + Intronic
1036437213 8:8745723-8745745 GAGGCTGGGTGGAGAAAGGTAGG - Intergenic
1036773186 8:11592700-11592722 GAGGCAGGTGGCAGGCAGGATGG - Intergenic
1037505957 8:19529426-19529448 AAGGCTGGTGGCAAACAAGTAGG + Intronic
1037880267 8:22570225-22570247 GTGGCTGGATGGAGACAGATGGG + Intronic
1038265299 8:26034902-26034924 GAAGCTGGTTGGTGACAGCTTGG - Intronic
1038675716 8:29621060-29621082 CAGGGTGGAGGGAGAGAGGTTGG + Intergenic
1039265813 8:35822781-35822803 GAGGGTGGAGGGTGACAGGAGGG + Intergenic
1039472300 8:37821063-37821085 GAGGGTGGTGGGAGAGAGAGAGG - Intronic
1040484212 8:47854937-47854959 GAGGGTGGTGGGAGGTAGGTAGG - Intronic
1040559864 8:48514625-48514647 GCGGCTGGGCGGAGCCAGGTGGG + Intergenic
1041180625 8:55244209-55244231 GAGGCTGGAGGGTGAGAGGAGGG - Intronic
1041407835 8:57519763-57519785 GGGGCTGGTTGGAGAGATGTTGG - Intergenic
1042540554 8:69903554-69903576 GAGGCTGGTGGGGAAGAGGACGG + Intergenic
1044126237 8:88461143-88461165 GAGGTTGGTGGGTGAGAGGAAGG - Intergenic
1044520798 8:93197198-93197220 GAGGCTAGTGGGACACAGAGAGG + Intergenic
1044773038 8:95657735-95657757 GAGGGTGGAGGGAAACAGGTTGG + Intergenic
1045064224 8:98431302-98431324 GAGGCTTGTGGGAGGCTGGGAGG + Exonic
1045385667 8:101668851-101668873 GAGGCTGGAGAGAGAGGGGTAGG - Exonic
1045457433 8:102395098-102395120 GAGGCTGGTGGGAGAGCTGTAGG - Intronic
1045879568 8:107021763-107021785 GGGGAGGGTGGGAGAGAGGTGGG + Intergenic
1047927636 8:129696992-129697014 GAGGGAGGTGGGAGAGAGGGAGG + Intergenic
1047953669 8:129956820-129956842 GAGGCTGGGGGGAGGGAGGGAGG - Intronic
1048035648 8:130674800-130674822 GATGCTGGTAGGACACAGGAAGG - Intergenic
1049013754 8:139905593-139905615 GGGACTGGTGGGAGAATGGTAGG + Intronic
1049206210 8:141364833-141364855 GGGGCTGGTGGGTGACACGCAGG - Intronic
1050318728 9:4429293-4429315 GAGGCTGGAGAGAGGGAGGTAGG - Intergenic
1051057938 9:13009699-13009721 GAGGCCAGTGGGAGAAATGTAGG + Intergenic
1051080194 9:13285215-13285237 GATGGTGGTAGGAGACAGGAGGG - Intergenic
1051483650 9:17585605-17585627 TAAGCAGGTGGGAAACAGGTGGG + Intronic
1051804501 9:20976986-20977008 TAGGCTGGTGAGAAACATGTTGG - Intronic
1052311936 9:27076845-27076867 GAGCTTGGTGGGAGATAGTTTGG + Intergenic
1052855710 9:33404934-33404956 GAGGCTGATGGGAGCCAGTAGGG + Intergenic
1052901418 9:33797614-33797636 GAGGCTGGTGGTAGTGGGGTGGG - Intronic
1052984787 9:34478975-34478997 GAGGGAGGTAGGAGAAAGGTGGG + Intronic
1053302342 9:36960974-36960996 GAGGAGGTGGGGAGACAGGTGGG - Intronic
1054337126 9:63817278-63817300 GAGGCTGGCGGGACACGGGTTGG + Intergenic
1054460307 9:65458851-65458873 GACGCGGGTGGGAGAGGGGTGGG - Intergenic
1055531421 9:77187993-77188015 GGGACTGGTGGGAGGCAGTTGGG + Intronic
1055630628 9:78220008-78220030 CAGGCTGGGGGCAGACAGGAGGG + Intergenic
1055637975 9:78296700-78296722 GGGGCTGGTGGTGGAGAGGTGGG + Intergenic
1055690642 9:78826722-78826744 GAGGCAGGTGGCAGCCAGATGGG + Intergenic
1057059610 9:91991784-91991806 GAGGCGGGTGGGGGGCAGGCTGG - Intergenic
1057072919 9:92115514-92115536 GAGGCTGGACGGGGTCAGGTGGG + Intergenic
1057219248 9:93247219-93247241 GGGGCTGGTGGCAGACGGGAAGG - Intronic
1058108911 9:101008044-101008066 GAGGCTGGAGAGTGACAGGAGGG + Intergenic
1058147433 9:101427536-101427558 GAGGCTGGATGGACACTGGTCGG + Exonic
1058270670 9:102968056-102968078 GATGGTGGTGGGAGACAGACAGG - Intergenic
1059235585 9:112758205-112758227 GAGGATGGGGGGTGGCAGGTGGG - Intronic
1059404214 9:114089891-114089913 GAGTCTGGTGGGGGACAGACAGG - Intronic
1059421635 9:114196091-114196113 GGGGCTGGGGAGAGGCAGGTGGG - Intronic
1059604657 9:115821340-115821362 GAGTCTAGTGGGAGACACTTGGG + Intergenic
1060109641 9:120897316-120897338 GAGGCAGATGGGAGTCAGGGAGG + Intergenic
1060150633 9:121286118-121286140 GAGGCTGGGGGGAGCTATGTGGG - Intronic
1060186315 9:121566225-121566247 GAGGCTGGTGAGAGATGGGACGG - Intergenic
1060494316 9:124106725-124106747 GAGGCAGGGAAGAGACAGGTTGG + Intergenic
1060516001 9:124266143-124266165 GGGGCCGGTGGGTGAGAGGTGGG + Intronic
1060597375 9:124856522-124856544 GCGCCTGGTGGGAGACTGCTGGG - Exonic
1060783379 9:126430279-126430301 CAGGCTGGTGGGACACGGGTGGG - Intronic
1061185161 9:129048708-129048730 GGTGTTGGTGGGAGAAAGGTGGG + Intronic
1061316068 9:129796509-129796531 GAGGCTGGTGGCAGGGAGGGAGG + Intergenic
1061592016 9:131603802-131603824 CAGGCTGCTGGGAGCCAGCTCGG - Intronic
1061777899 9:132978061-132978083 GAGGCTTGTGAGAGCCAGGCTGG - Intronic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1062079981 9:134618690-134618712 GAGGGAGGTGGGAGTCAGATGGG + Intergenic
1062276914 9:135735647-135735669 GAGGCCTGTGGGAGGCAGGTGGG - Intronic
1062451111 9:136616202-136616224 GAGGCTGGTGGGATCCGAGTGGG - Intergenic
1062680741 9:137778559-137778581 GAGGCTGGAGGCAGACAGAGGGG - Intronic
1203377063 Un_KI270442v1:384699-384721 GAGGCTGGCGGGACAAAGGTTGG + Intergenic
1203577377 Un_KI270745v1:19867-19889 TAGGCTGCTGGGAGACAGGCAGG - Intergenic
1186487714 X:9946388-9946410 GAGGCAGGTGGGAGAGAGTCAGG + Intronic
1186509419 X:10119302-10119324 GAAGGTGGTGGGAGAGAGGAGGG - Intronic
1186972263 X:14860367-14860389 GATACTGGTGGGAGAAAGGGAGG - Intronic
1187578639 X:20585082-20585104 GAGGCTGGGAAGAGACAGGCAGG + Intergenic
1188585393 X:31768321-31768343 AGGGATGGTGGGAGACAGGAGGG - Intronic
1188745686 X:33839765-33839787 GTGGCTGGAGGGTGGCAGGTTGG - Intergenic
1189700994 X:43716226-43716248 GAGGTTGGGGTGAGACAGGTAGG + Intronic
1189701659 X:43719547-43719569 GGGGTAGATGGGAGACAGGTAGG + Intronic
1190391361 X:49934997-49935019 GAGAATGGTGAGAGACAGGTAGG + Intronic
1192075783 X:67994712-67994734 GAGGGTGGAGGGAGGCAGGAGGG - Intergenic
1192261363 X:69507405-69507427 GAGGCGGGAGGGAGACTGCTAGG - Intronic
1192358302 X:70423398-70423420 AAGGCTGGGGGGCTACAGGTGGG + Intronic
1192616191 X:72625245-72625267 GAGGATGGAGGGCGAGAGGTAGG - Intronic
1194878870 X:99225333-99225355 GAGGGTGGAGGGAGAAAGGAGGG - Intergenic
1195129696 X:101840237-101840259 GAGGCTTGGTGGAGACAGGCGGG + Intronic
1195176542 X:102319592-102319614 GAGGCTTGGTGGAGACAGGCGGG - Intronic
1195182322 X:102367501-102367523 GAGGCTTGGTGGAGACAGGCGGG + Intronic
1195202409 X:102564284-102564306 GAGGCTTGGTGGAGACAGGCGGG - Intergenic
1195255036 X:103082017-103082039 GAGGCTGGGTGGAGACAGGTGGG + Intronic
1195293438 X:103451386-103451408 GAAGCTGGAGGGAGACAGGTAGG - Intergenic
1195322095 X:103728537-103728559 GAGGGAGGAGGGAGACCGGTAGG + Exonic
1195649553 X:107271044-107271066 GAGGATGGTTTGAGACAGGGAGG - Intergenic
1195969555 X:110458417-110458439 GAGGTTGGTGGGTGAGAGGATGG - Intergenic
1197633195 X:128885723-128885745 CAGGGTGGTGGGAGAGGGGTAGG + Intergenic
1199213571 X:145242298-145242320 GGGGCTGGTGGTAGACAGCTTGG + Intergenic
1200247155 X:154532305-154532327 GAGGCCGGTGGCACACAGGGAGG + Intronic
1200992245 Y:9356392-9356414 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1200994894 Y:9376670-9376692 GAGCCAGGTGGGAGGCACGTGGG - Intronic
1200997559 Y:9397016-9397038 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201000071 Y:9465552-9465574 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201002732 Y:9485862-9485884 GAGCCAGGTGGGAGGCACGTGGG - Intronic
1201005387 Y:9506146-9506168 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201008050 Y:9526475-9526497 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201010664 Y:9546665-9546687 GAGCCAGGTGGGAGGCACGTGGG - Intergenic
1201146226 Y:11066910-11066932 GAGGAAGGTGGGAGAGAGGAAGG + Intergenic