ID: 961463161

View in Genome Browser
Species Human (GRCh38)
Location 3:127065840-127065862
Sequence GGCCTGCCCCAGAACTCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961463161_961463166 10 Left 961463161 3:127065840-127065862 CCGGGAGAGTTCTGGGGCAGGCC No data
Right 961463166 3:127065873-127065895 TGCCGCTGTAGGAGGTCCCGTGG No data
961463161_961463164 -1 Left 961463161 3:127065840-127065862 CCGGGAGAGTTCTGGGGCAGGCC No data
Right 961463164 3:127065862-127065884 CCAGCTCATTTTGCCGCTGTAGG No data
961463161_961463165 2 Left 961463161 3:127065840-127065862 CCGGGAGAGTTCTGGGGCAGGCC No data
Right 961463165 3:127065865-127065887 GCTCATTTTGCCGCTGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961463161 Original CRISPR GGCCTGCCCCAGAACTCTCC CGG (reversed) Intergenic
No off target data available for this crispr