ID: 961465672

View in Genome Browser
Species Human (GRCh38)
Location 3:127079605-127079627
Sequence CAGGAGACATAGATGGAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961465665_961465672 28 Left 961465665 3:127079554-127079576 CCACTGGACTCTAGTGGTCCAAG No data
Right 961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG No data
961465667_961465672 10 Left 961465667 3:127079572-127079594 CCAAGAAGGCACAAGTGCATGCT No data
Right 961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961465672 Original CRISPR CAGGAGACATAGATGGAGAG TGG Intergenic
No off target data available for this crispr