ID: 961465853

View in Genome Browser
Species Human (GRCh38)
Location 3:127081203-127081225
Sequence AAACATGCCGGAGCAGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961465853_961465866 28 Left 961465853 3:127081203-127081225 CCCTGCACTGCTCCGGCATGTTT No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465853_961465865 27 Left 961465853 3:127081203-127081225 CCCTGCACTGCTCCGGCATGTTT No data
Right 961465865 3:127081253-127081275 CCTCAGTCAGCCCAAAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961465853 Original CRISPR AAACATGCCGGAGCAGTGCA GGG (reversed) Intergenic
No off target data available for this crispr