ID: 961465854

View in Genome Browser
Species Human (GRCh38)
Location 3:127081204-127081226
Sequence GAAACATGCCGGAGCAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961465854_961465866 27 Left 961465854 3:127081204-127081226 CCTGCACTGCTCCGGCATGTTTC No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465854_961465865 26 Left 961465854 3:127081204-127081226 CCTGCACTGCTCCGGCATGTTTC No data
Right 961465865 3:127081253-127081275 CCTCAGTCAGCCCAAAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961465854 Original CRISPR GAAACATGCCGGAGCAGTGC AGG (reversed) Intergenic
No off target data available for this crispr