ID: 961465855

View in Genome Browser
Species Human (GRCh38)
Location 3:127081215-127081237
Sequence ACTTGGTATGGGAAACATGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961465855_961465866 16 Left 961465855 3:127081215-127081237 CCGGCATGTTTCCCATACCAAGT No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465855_961465865 15 Left 961465855 3:127081215-127081237 CCGGCATGTTTCCCATACCAAGT No data
Right 961465865 3:127081253-127081275 CCTCAGTCAGCCCAAAAATTTGG No data
961465855_961465867 20 Left 961465855 3:127081215-127081237 CCGGCATGTTTCCCATACCAAGT No data
Right 961465867 3:127081258-127081280 GTCAGCCCAAAAATTTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961465855 Original CRISPR ACTTGGTATGGGAAACATGC CGG (reversed) Intergenic
No off target data available for this crispr