ID: 961465858

View in Genome Browser
Species Human (GRCh38)
Location 3:127081232-127081254
Sequence GGGGGTTTAAATGGGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961465858_961465865 -2 Left 961465858 3:127081232-127081254 CCAAGTTTCCCATTTAAACCCCC No data
Right 961465865 3:127081253-127081275 CCTCAGTCAGCCCAAAAATTTGG No data
961465858_961465871 25 Left 961465858 3:127081232-127081254 CCAAGTTTCCCATTTAAACCCCC No data
Right 961465871 3:127081280-127081302 GCTTCTTTGAGGCTGATGCCTGG No data
961465858_961465866 -1 Left 961465858 3:127081232-127081254 CCAAGTTTCCCATTTAAACCCCC No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465858_961465867 3 Left 961465858 3:127081232-127081254 CCAAGTTTCCCATTTAAACCCCC No data
Right 961465867 3:127081258-127081280 GTCAGCCCAAAAATTTGGGTTGG No data
961465858_961465870 14 Left 961465858 3:127081232-127081254 CCAAGTTTCCCATTTAAACCCCC No data
Right 961465870 3:127081269-127081291 AATTTGGGTTGGCTTCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961465858 Original CRISPR GGGGGTTTAAATGGGAAACT TGG (reversed) Intergenic
No off target data available for this crispr