ID: 961465859

View in Genome Browser
Species Human (GRCh38)
Location 3:127081240-127081262
Sequence CTGACTGAGGGGGTTTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961465859_961465870 6 Left 961465859 3:127081240-127081262 CCCATTTAAACCCCCTCAGTCAG No data
Right 961465870 3:127081269-127081291 AATTTGGGTTGGCTTCTTTGAGG No data
961465859_961465867 -5 Left 961465859 3:127081240-127081262 CCCATTTAAACCCCCTCAGTCAG No data
Right 961465867 3:127081258-127081280 GTCAGCCCAAAAATTTGGGTTGG No data
961465859_961465866 -9 Left 961465859 3:127081240-127081262 CCCATTTAAACCCCCTCAGTCAG No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465859_961465865 -10 Left 961465859 3:127081240-127081262 CCCATTTAAACCCCCTCAGTCAG No data
Right 961465865 3:127081253-127081275 CCTCAGTCAGCCCAAAAATTTGG No data
961465859_961465871 17 Left 961465859 3:127081240-127081262 CCCATTTAAACCCCCTCAGTCAG No data
Right 961465871 3:127081280-127081302 GCTTCTTTGAGGCTGATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961465859 Original CRISPR CTGACTGAGGGGGTTTAAAT GGG (reversed) Intergenic
No off target data available for this crispr