ID: 961465866

View in Genome Browser
Species Human (GRCh38)
Location 3:127081254-127081276
Sequence CTCAGTCAGCCCAAAAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961465859_961465866 -9 Left 961465859 3:127081240-127081262 CCCATTTAAACCCCCTCAGTCAG No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465853_961465866 28 Left 961465853 3:127081203-127081225 CCCTGCACTGCTCCGGCATGTTT No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465858_961465866 -1 Left 961465858 3:127081232-127081254 CCAAGTTTCCCATTTAAACCCCC No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465856_961465866 5 Left 961465856 3:127081226-127081248 CCCATACCAAGTTTCCCATTTAA No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465860_961465866 -10 Left 961465860 3:127081241-127081263 CCATTTAAACCCCCTCAGTCAGC No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465854_961465866 27 Left 961465854 3:127081204-127081226 CCTGCACTGCTCCGGCATGTTTC No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465857_961465866 4 Left 961465857 3:127081227-127081249 CCATACCAAGTTTCCCATTTAAA No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data
961465855_961465866 16 Left 961465855 3:127081215-127081237 CCGGCATGTTTCCCATACCAAGT No data
Right 961465866 3:127081254-127081276 CTCAGTCAGCCCAAAAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961465866 Original CRISPR CTCAGTCAGCCCAAAAATTT GGG Intergenic
No off target data available for this crispr