ID: 961465867

View in Genome Browser
Species Human (GRCh38)
Location 3:127081258-127081280
Sequence GTCAGCCCAAAAATTTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961465860_961465867 -6 Left 961465860 3:127081241-127081263 CCATTTAAACCCCCTCAGTCAGC No data
Right 961465867 3:127081258-127081280 GTCAGCCCAAAAATTTGGGTTGG No data
961465858_961465867 3 Left 961465858 3:127081232-127081254 CCAAGTTTCCCATTTAAACCCCC No data
Right 961465867 3:127081258-127081280 GTCAGCCCAAAAATTTGGGTTGG No data
961465857_961465867 8 Left 961465857 3:127081227-127081249 CCATACCAAGTTTCCCATTTAAA No data
Right 961465867 3:127081258-127081280 GTCAGCCCAAAAATTTGGGTTGG No data
961465859_961465867 -5 Left 961465859 3:127081240-127081262 CCCATTTAAACCCCCTCAGTCAG No data
Right 961465867 3:127081258-127081280 GTCAGCCCAAAAATTTGGGTTGG No data
961465856_961465867 9 Left 961465856 3:127081226-127081248 CCCATACCAAGTTTCCCATTTAA No data
Right 961465867 3:127081258-127081280 GTCAGCCCAAAAATTTGGGTTGG No data
961465855_961465867 20 Left 961465855 3:127081215-127081237 CCGGCATGTTTCCCATACCAAGT No data
Right 961465867 3:127081258-127081280 GTCAGCCCAAAAATTTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961465867 Original CRISPR GTCAGCCCAAAAATTTGGGT TGG Intergenic
No off target data available for this crispr