ID: 961466605

View in Genome Browser
Species Human (GRCh38)
Location 3:127085592-127085614
Sequence ATGGGTTTATGAGCTCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961466605_961466616 -3 Left 961466605 3:127085592-127085614 CCCCTCAGAGCTCATAAACCCAT No data
Right 961466616 3:127085612-127085634 CATGGGGGCTGTGCAGGGAGAGG No data
961466605_961466618 5 Left 961466605 3:127085592-127085614 CCCCTCAGAGCTCATAAACCCAT No data
Right 961466618 3:127085620-127085642 CTGTGCAGGGAGAGGGAGTCTGG No data
961466605_961466613 -8 Left 961466605 3:127085592-127085614 CCCCTCAGAGCTCATAAACCCAT No data
Right 961466613 3:127085607-127085629 AAACCCATGGGGGCTGTGCAGGG No data
961466605_961466619 12 Left 961466605 3:127085592-127085614 CCCCTCAGAGCTCATAAACCCAT No data
Right 961466619 3:127085627-127085649 GGGAGAGGGAGTCTGGAGACCGG No data
961466605_961466622 26 Left 961466605 3:127085592-127085614 CCCCTCAGAGCTCATAAACCCAT No data
Right 961466622 3:127085641-127085663 GGAGACCGGGAACACCGGAAAGG No data
961466605_961466621 21 Left 961466605 3:127085592-127085614 CCCCTCAGAGCTCATAAACCCAT No data
Right 961466621 3:127085636-127085658 AGTCTGGAGACCGGGAACACCGG No data
961466605_961466617 -2 Left 961466605 3:127085592-127085614 CCCCTCAGAGCTCATAAACCCAT No data
Right 961466617 3:127085613-127085635 ATGGGGGCTGTGCAGGGAGAGGG No data
961466605_961466620 13 Left 961466605 3:127085592-127085614 CCCCTCAGAGCTCATAAACCCAT No data
Right 961466620 3:127085628-127085650 GGAGAGGGAGTCTGGAGACCGGG No data
961466605_961466612 -9 Left 961466605 3:127085592-127085614 CCCCTCAGAGCTCATAAACCCAT No data
Right 961466612 3:127085606-127085628 TAAACCCATGGGGGCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961466605 Original CRISPR ATGGGTTTATGAGCTCTGAG GGG (reversed) Intergenic
No off target data available for this crispr