ID: 961468949

View in Genome Browser
Species Human (GRCh38)
Location 3:127099456-127099478
Sequence TCGGAGCCACCAAAGGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961468944_961468949 14 Left 961468944 3:127099419-127099441 CCTGGGGTGTGACTACTGCAGAA No data
Right 961468949 3:127099456-127099478 TCGGAGCCACCAAAGGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961468949 Original CRISPR TCGGAGCCACCAAAGGACAG GGG Intergenic
No off target data available for this crispr