ID: 961473578

View in Genome Browser
Species Human (GRCh38)
Location 3:127133703-127133725
Sequence GACCCACTTTGTAATCACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961473570_961473578 15 Left 961473570 3:127133665-127133687 CCTTTCTGACTCTGACCCTCTGG No data
Right 961473578 3:127133703-127133725 GACCCACTTTGTAATCACATTGG No data
961473572_961473578 0 Left 961473572 3:127133680-127133702 CCCTCTGGCCTCCCTCTTATAAG No data
Right 961473578 3:127133703-127133725 GACCCACTTTGTAATCACATTGG No data
961473575_961473578 -8 Left 961473575 3:127133688-127133710 CCTCCCTCTTATAAGGACCCACT No data
Right 961473578 3:127133703-127133725 GACCCACTTTGTAATCACATTGG No data
961473568_961473578 26 Left 961473568 3:127133654-127133676 CCTCAAAGGTCCCTTTCTGACTC No data
Right 961473578 3:127133703-127133725 GACCCACTTTGTAATCACATTGG No data
961473569_961473578 16 Left 961473569 3:127133664-127133686 CCCTTTCTGACTCTGACCCTCTG No data
Right 961473578 3:127133703-127133725 GACCCACTTTGTAATCACATTGG No data
961473573_961473578 -1 Left 961473573 3:127133681-127133703 CCTCTGGCCTCCCTCTTATAAGG No data
Right 961473578 3:127133703-127133725 GACCCACTTTGTAATCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961473578 Original CRISPR GACCCACTTTGTAATCACAT TGG Intergenic
No off target data available for this crispr