ID: 961474277

View in Genome Browser
Species Human (GRCh38)
Location 3:127136968-127136990
Sequence GAGGATGAGCTGGGGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961474277_961474285 3 Left 961474277 3:127136968-127136990 CCTCTGTCCCCCAGCTCATCCTC No data
Right 961474285 3:127136994-127137016 TGGTGCCACCTGATGCCCATTGG No data
961474277_961474292 30 Left 961474277 3:127136968-127136990 CCTCTGTCCCCCAGCTCATCCTC No data
Right 961474292 3:127137021-127137043 CACAGTTTCAGTCCTAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961474277 Original CRISPR GAGGATGAGCTGGGGGACAG AGG (reversed) Intergenic
No off target data available for this crispr