ID: 961475099

View in Genome Browser
Species Human (GRCh38)
Location 3:127141185-127141207
Sequence CCTGGCCACAAAGAGTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961475099_961475109 13 Left 961475099 3:127141185-127141207 CCTCATAACTCTTTGTGGCCAGG No data
Right 961475109 3:127141221-127141243 CCTTGGGAAGCCTGCTGTTTGGG No data
961475099_961475111 21 Left 961475099 3:127141185-127141207 CCTCATAACTCTTTGTGGCCAGG No data
Right 961475111 3:127141229-127141251 AGCCTGCTGTTTGGGGCACCAGG No data
961475099_961475110 14 Left 961475099 3:127141185-127141207 CCTCATAACTCTTTGTGGCCAGG No data
Right 961475110 3:127141222-127141244 CTTGGGAAGCCTGCTGTTTGGGG No data
961475099_961475104 -4 Left 961475099 3:127141185-127141207 CCTCATAACTCTTTGTGGCCAGG No data
Right 961475104 3:127141204-127141226 CAGGGTGGCTGCTCCTGCCTTGG No data
961475099_961475107 12 Left 961475099 3:127141185-127141207 CCTCATAACTCTTTGTGGCCAGG No data
Right 961475107 3:127141220-127141242 GCCTTGGGAAGCCTGCTGTTTGG No data
961475099_961475105 -3 Left 961475099 3:127141185-127141207 CCTCATAACTCTTTGTGGCCAGG No data
Right 961475105 3:127141205-127141227 AGGGTGGCTGCTCCTGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961475099 Original CRISPR CCTGGCCACAAAGAGTTATG AGG (reversed) Intergenic
No off target data available for this crispr