ID: 961475239

View in Genome Browser
Species Human (GRCh38)
Location 3:127141855-127141877
Sequence CTGTGTTAGGGGAGGAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961475239_961475249 17 Left 961475239 3:127141855-127141877 CCAGGCCTCCTCCCCTAACACAG No data
Right 961475249 3:127141895-127141917 TCTCATGAGAAGGATATTCCTGG No data
961475239_961475248 7 Left 961475239 3:127141855-127141877 CCAGGCCTCCTCCCCTAACACAG No data
Right 961475248 3:127141885-127141907 TGTTTGTAGTTCTCATGAGAAGG No data
961475239_961475250 24 Left 961475239 3:127141855-127141877 CCAGGCCTCCTCCCCTAACACAG No data
Right 961475250 3:127141902-127141924 AGAAGGATATTCCTGGCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961475239 Original CRISPR CTGTGTTAGGGGAGGAGGCC TGG (reversed) Intergenic
No off target data available for this crispr