ID: 961480135

View in Genome Browser
Species Human (GRCh38)
Location 3:127174245-127174267
Sequence CTGCACTGCACCTCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961480129_961480135 17 Left 961480129 3:127174205-127174227 CCATCTCTCTACCTCAGCATTCC No data
Right 961480135 3:127174245-127174267 CTGCACTGCACCTCTGCTGCTGG No data
961480134_961480135 -5 Left 961480134 3:127174227-127174249 CCATCTGCAAGTTGGGTGCTGCA No data
Right 961480135 3:127174245-127174267 CTGCACTGCACCTCTGCTGCTGG No data
961480133_961480135 -4 Left 961480133 3:127174226-127174248 CCCATCTGCAAGTTGGGTGCTGC No data
Right 961480135 3:127174245-127174267 CTGCACTGCACCTCTGCTGCTGG No data
961480127_961480135 22 Left 961480127 3:127174200-127174222 CCTTCCCATCTCTCTACCTCAGC No data
Right 961480135 3:127174245-127174267 CTGCACTGCACCTCTGCTGCTGG No data
961480128_961480135 18 Left 961480128 3:127174204-127174226 CCCATCTCTCTACCTCAGCATTC No data
Right 961480135 3:127174245-127174267 CTGCACTGCACCTCTGCTGCTGG No data
961480130_961480135 6 Left 961480130 3:127174216-127174238 CCTCAGCATTCCCATCTGCAAGT No data
Right 961480135 3:127174245-127174267 CTGCACTGCACCTCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961480135 Original CRISPR CTGCACTGCACCTCTGCTGC TGG Intergenic
No off target data available for this crispr