ID: 961481954

View in Genome Browser
Species Human (GRCh38)
Location 3:127186830-127186852
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961481951_961481954 1 Left 961481951 3:127186806-127186828 CCCATTATTAAACTGCGTTATTT No data
Right 961481954 3:127186830-127186852 CCTTTCATTGTTGAGTTTTGAGG No data
961481952_961481954 0 Left 961481952 3:127186807-127186829 CCATTATTAAACTGCGTTATTTG No data
Right 961481954 3:127186830-127186852 CCTTTCATTGTTGAGTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr