ID: 961482550

View in Genome Browser
Species Human (GRCh38)
Location 3:127193367-127193389
Sequence GCACTCTCCCACCCAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961482545_961482550 8 Left 961482545 3:127193336-127193358 CCTGAGGACCTTCTCTGACACCA 0: 1
1: 0
2: 1
3: 26
4: 221
Right 961482550 3:127193367-127193389 GCACTCTCCCACCCAACTCCTGG 0: 1
1: 0
2: 3
3: 27
4: 246
961482546_961482550 0 Left 961482546 3:127193344-127193366 CCTTCTCTGACACCATCCTCTCC 0: 1
1: 1
2: 2
3: 76
4: 702
Right 961482550 3:127193367-127193389 GCACTCTCCCACCCAACTCCTGG 0: 1
1: 0
2: 3
3: 27
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961482550 Original CRISPR GCACTCTCCCACCCAACTCC TGG Intronic
900265089 1:1753303-1753325 GCCCACCCCCACCCACCTCCTGG - Intronic
900468955 1:2841707-2841729 GCACTCTCCCCCAAAACTGCAGG - Intergenic
901775590 1:11558587-11558609 CCAGTCCCCCACCCACCTCCAGG - Intergenic
901779447 1:11583784-11583806 GAACCCTGCCACTCAACTCCAGG - Intergenic
901898123 1:12332609-12332631 ACCCTCTCCCACCCAACTCCAGG - Intronic
902271824 1:15310306-15310328 GCAGTCCCCCTCCCCACTCCAGG + Intronic
902804542 1:18852730-18852752 CCACTCTCCCACTCTCCTCCTGG + Intronic
905167578 1:36092020-36092042 GCACTTTCTCAAGCAACTCCTGG + Exonic
905639246 1:39577035-39577057 ACACCCTCCCACCCATCACCCGG + Intergenic
906702841 1:47872367-47872389 CCACTCTCCCTGCCACCTCCGGG + Intronic
907642303 1:56203293-56203315 GCCCTCTCTCACACAACTCGTGG - Intergenic
907742954 1:57184873-57184895 GCTCTCACCCACTGAACTCCAGG + Intronic
908415535 1:63909949-63909971 TCACTCTCCCACACACTTCCAGG - Intronic
909581007 1:77234767-77234789 TCTCTCTCCCATCCAACTCCTGG - Intergenic
909666019 1:78134473-78134495 GTACTCTCCCACCCCATGCCAGG + Intronic
911123956 1:94322983-94323005 GCAGTCTCCTCCCCACCTCCAGG + Intergenic
911889679 1:103352149-103352171 GCACTCTCACAGGCAAATCCAGG + Intergenic
912457195 1:109806126-109806148 CCACCCACCCTCCCAACTCCTGG + Intergenic
912634460 1:111279045-111279067 AAACTCTGCCCCCCAACTCCAGG + Intergenic
913337119 1:117718604-117718626 CCACCCTCCCACCCCACTACAGG + Intergenic
915913746 1:159929451-159929473 AGACTCTCTCACCCAACACCAGG + Intronic
919746125 1:201010218-201010240 GCCCTCCCCCGCCCAACTCCTGG - Intronic
919943456 1:202304049-202304071 GCCCTCTCCAGCCCAGCTCCTGG + Intronic
921492849 1:215799909-215799931 GCACTCTGCCTCCCGCCTCCCGG - Intronic
922752543 1:228077306-228077328 CCTCTCTCGCACCCACCTCCAGG + Intergenic
924454688 1:244209910-244209932 TCACTGTAACACCCAACTCCTGG + Intergenic
1064605031 10:17030276-17030298 CCACCCTCCCACCCCACCCCCGG + Intronic
1066059361 10:31708359-31708381 GCACCCCCCCACCCAATCCCAGG + Intergenic
1068884000 10:62079751-62079773 CAACTCTCCCACCCACTTCCAGG + Intronic
1069604870 10:69732711-69732733 GCCCTCTCCCTGCCAACCCCAGG - Intergenic
1069980336 10:72248027-72248049 GCACAATCCCAGCCAACTTCTGG - Intergenic
1072633834 10:97164783-97164805 GCTCCCTCCCACCCCACCCCTGG - Intronic
1076001060 10:126913410-126913432 GGGCTGTCCCACACAACTCCAGG + Intronic
1077086685 11:755988-756010 GCACTCACCCGCCCAGCTTCCGG - Exonic
1080258785 11:30323225-30323247 CCACTCTCCCACTCCTCTCCAGG - Intronic
1081732857 11:45383867-45383889 GCCCCCTCCAACCCCACTCCTGG + Intergenic
1083614951 11:64021645-64021667 GCCCCCACCCCCCCAACTCCTGG - Intronic
1084146444 11:67267407-67267429 GCACTCTCGAGCCCAACTCCAGG - Intronic
1085062706 11:73462429-73462451 TCACCCTCCCCCCCAGCTCCTGG - Intronic
1085817393 11:79754498-79754520 GAACTTTCCCTTCCAACTCCAGG + Intergenic
1086599718 11:88617861-88617883 AGCCTCTCCCACCCACCTCCTGG - Intronic
1087165059 11:94994775-94994797 TCTCTCTCCCACCCAACCCCAGG - Intronic
1088379155 11:109173916-109173938 ACACTATCCCAGCCAACACCAGG - Intergenic
1089762828 11:120740796-120740818 GGCCTCTCCCACCCTTCTCCTGG + Intronic
1090212715 11:124934066-124934088 CCTCTCTGCCACCCAACTCCAGG + Intronic
1091710890 12:2739631-2739653 GCCCTCTCCCAGCCAAGCCCTGG + Intergenic
1091816758 12:3444742-3444764 GCAATCTCCCACGGAACTGCTGG - Intronic
1092241575 12:6839275-6839297 ACACTCTCCTCCCCAACCCCAGG + Exonic
1096484689 12:51970998-51971020 GCACACTCCCACACCCCTCCTGG + Intronic
1098209800 12:68151699-68151721 GGACTCTGACACCCTACTCCAGG + Intergenic
1101629760 12:106481490-106481512 CCACTCACCCACCCGATTCCTGG - Intronic
1103443076 12:120978123-120978145 GGACCCTTCCACCCCACTCCCGG - Intergenic
1103521201 12:121537770-121537792 GCACACTCGCACCCGACCCCGGG + Intronic
1103565106 12:121811549-121811571 GCACCCTCACCCCCAACCCCTGG - Intronic
1103716314 12:122947385-122947407 GCCATCTCCCACCCAGCCCCCGG - Intronic
1106026891 13:25964072-25964094 GCACTCGGCCACCCAGCACCTGG + Intronic
1106150893 13:27100647-27100669 TCACTCACCCACCCATTTCCGGG + Intronic
1108816708 13:54301445-54301467 TTACTCTTCCCCCCAACTCCAGG - Intergenic
1111128823 13:83947993-83948015 CCCCTCTCCCACCCCAGTCCAGG + Intergenic
1113851092 13:113418679-113418701 GAACTCTCCATCCCAAGTCCTGG + Intergenic
1114954744 14:27804231-27804253 GCAGAGTCCCACCCCACTCCTGG - Intergenic
1116538345 14:46064554-46064576 CCACTCTCCCTCCCAACCCCTGG + Intergenic
1117798209 14:59416382-59416404 GAACTCTCACACCCAACTGCTGG - Intergenic
1117975906 14:61296414-61296436 TCACACTGCCACCCAACTCTGGG - Intronic
1118709425 14:68507581-68507603 GCACTCTCTAAACAAACTCCTGG + Intronic
1119037758 14:71245248-71245270 GCCCTCTCTCACCTAACTTCTGG - Intergenic
1121837965 14:97108882-97108904 GCTCTCTCTAACCCAGCTCCAGG - Intergenic
1123697849 15:22891918-22891940 GCCCTCTCCATCCCAGCTCCAGG + Intronic
1124597450 15:31102648-31102670 TCACTCCCCCACCCAATGCCTGG + Intronic
1125325764 15:38534636-38534658 CTTCTCTCCCACCCAACTGCTGG + Intronic
1126736330 15:51735388-51735410 GCACTCTCCCACCCCTATTCAGG - Intronic
1127029743 15:54848872-54848894 CCACTCTCTCATCCAGCTCCTGG - Intergenic
1128628160 15:69233481-69233503 GCTTTCTCCCTCCCAACCCCAGG + Intronic
1129175591 15:73837703-73837725 GCACCCTGCCACCCTCCTCCTGG - Intergenic
1129524440 15:76204876-76204898 GGACCCTCCCACCCACCTCTAGG - Exonic
1130071175 15:80647735-80647757 GGAGTCTGCCACCCACCTCCAGG - Intergenic
1130935028 15:88462581-88462603 GCACTCTCAGACACCACTCCTGG + Intronic
1132594856 16:744032-744054 GCAACCTCCCACCCAACCACCGG - Intronic
1132954018 16:2581435-2581457 GCCCTCCCCCACCCACCTCGAGG - Intronic
1132960327 16:2618728-2618750 GCCCTCCCCCACCCACCTCGAGG + Intergenic
1133403952 16:5508510-5508532 GCAATCTCCCACCCGACCTCGGG - Intergenic
1134907587 16:17994205-17994227 GCACTCTTCCATCCAACTGTTGG + Intergenic
1135187234 16:20325881-20325903 ACCCTCTCCCACCCTCCTCCAGG + Intronic
1135307407 16:21379007-21379029 CCAGTCTCTCACCCAACTACAGG + Intergenic
1135938580 16:26801619-26801641 GCACTCTCCCTCCCATAGCCTGG + Intergenic
1137753129 16:50881264-50881286 TCACCTTCCCACCCTACTCCTGG + Intergenic
1137788564 16:51155478-51155500 GCTCTGTCCCACCCACCTCCGGG - Intergenic
1138323088 16:56135974-56135996 GCACTCTCTCACTCCACCCCTGG - Intergenic
1139363451 16:66418227-66418249 CCACTCTCCACCTCAACTCCTGG - Intergenic
1140055491 16:71522020-71522042 CCACTCTCCAACTCTACTCCTGG + Intronic
1141144315 16:81518308-81518330 TCTCTCTGCTACCCAACTCCAGG - Intronic
1142202186 16:88766562-88766584 GCACACACCCACCTACCTCCGGG + Intronic
1142320527 16:89379642-89379664 GCTCTCTGCCTCCCACCTCCAGG + Intronic
1142685064 17:1572784-1572806 TCACTCTCCCACCCACCCTCAGG - Intronic
1142687857 17:1588010-1588032 TCACTCTCCCACCCACCCTCAGG - Intronic
1142733551 17:1879801-1879823 CCACTCCCTCCCCCAACTCCAGG - Intronic
1143172452 17:4938113-4938135 GCACCCTCCCACCCACCTCCAGG + Intronic
1143300022 17:5902180-5902202 GCCTTCTCACACCCAACCCCTGG - Intronic
1143515016 17:7415145-7415167 GCCCTCTCCCACCCCATACCGGG - Exonic
1143759511 17:9090862-9090884 GCTCTTGCCCACCCAGCTCCAGG - Intronic
1144939547 17:18928564-18928586 GCTATCTCCCACCACACTCCAGG - Intronic
1146053917 17:29572001-29572023 GCTCCCTCCGAGCCAACTCCCGG + Exonic
1146845416 17:36179010-36179032 GCCCCCTCCCACCCTGCTCCAGG - Intronic
1146873631 17:36390853-36390875 GCCCCCTCCCACCCTGCTCCAGG - Intronic
1146880990 17:36441941-36441963 GCCCCCTCCCACCCTGCTCCAGG - Intergenic
1147065757 17:37922020-37922042 GCCCCCTCCCACCCTGCTCCAGG + Intergenic
1147317499 17:39627753-39627775 GGACGCCCCCACCCCACTCCTGG - Intronic
1147367156 17:39966465-39966487 GCACTGCCCCACCCACATCCCGG - Intronic
1147679003 17:42227528-42227550 GCACTATGCCACACAGCTCCAGG - Exonic
1148555936 17:48578549-48578571 CCACCCACCCACCCAACACCAGG + Exonic
1148611008 17:48964612-48964634 CCACTCCCCCACCCCACCCCAGG + Intronic
1148740626 17:49890580-49890602 GCCCTCCCCCAGCCAGCTCCGGG + Intergenic
1149454519 17:56777136-56777158 GACCCCTCCCACCCTACTCCAGG + Intergenic
1149526344 17:57359009-57359031 CCATTCTCCCACCCAAGTTCTGG - Intronic
1151145286 17:72034731-72034753 GAACTCTCCCTCCCATCACCTGG + Intergenic
1151185024 17:72357615-72357637 GCACCCTCCCACTCCAGTCCTGG + Intergenic
1152425579 17:80216901-80216923 CCACTTTCCCTCCCACCTCCAGG - Intronic
1152636451 17:81432527-81432549 CCACCCTCCCACCCATCACCAGG + Intronic
1152738322 17:82008217-82008239 GCAGTCTCCCACCCAGCCACGGG - Intronic
1153326539 18:3826503-3826525 GCACTCTGCCACCAGACCCCAGG - Intronic
1153456049 18:5282963-5282985 GCTCCCTCCCACCCAACTATTGG + Intergenic
1155160698 18:23193076-23193098 ACACTCCCCCACCCAACTCTAGG - Intronic
1156077952 18:33303322-33303344 GCTTCCTCCCACCTAACTCCTGG - Intronic
1159768748 18:72522783-72522805 ACCCTCCCCCACCCAACCCCAGG - Intergenic
1160534179 18:79583573-79583595 GCTCTTTCTCTCCCAACTCCAGG - Intergenic
1160822653 19:1065762-1065784 GCACTCACATCCCCAACTCCTGG - Intergenic
1160846985 19:1170385-1170407 GCACTCTCGCCCCCAACCCCCGG - Intronic
1160969191 19:1759938-1759960 GCACCCTCCCACAAAACTTCAGG + Intronic
1161139223 19:2637947-2637969 CCTCTCTCCCTCCCAACTCAGGG - Intronic
1161267018 19:3368792-3368814 GGAGCCTCCCACCCAAGTCCTGG + Intronic
1161267762 19:3372700-3372722 GCACCCCCCCACCCCACTCCTGG - Intronic
1163155375 19:15437279-15437301 GCATCCTCCCACCCCATTCCAGG + Intronic
1164778274 19:30871776-30871798 GCTCTCTCCCTCCCACCTGCTGG - Intergenic
1166202669 19:41248665-41248687 CCACACTCCCACCCAACTATAGG + Intronic
1166222893 19:41376903-41376925 GCCCTCTCATCCCCAACTCCAGG - Intronic
1167517061 19:49929570-49929592 GAACTCTCCCACCCGGCCCCGGG - Intronic
1168724041 19:58570982-58571004 ACACTCACTCACCCATCTCCGGG + Exonic
925018002 2:546302-546324 GGAGCCTCCCACCGAACTCCAGG + Intergenic
925033720 2:671268-671290 GCCCTCCCACACCCAGCTCCAGG - Intronic
927174966 2:20399458-20399480 CCACTCTGCCTCCCACCTCCAGG - Intergenic
927266286 2:21155566-21155588 GCACTTTCAGACCCAACCCCTGG + Intergenic
927698221 2:25251855-25251877 GCTGCCTCCAACCCAACTCCTGG + Intronic
927841562 2:26448369-26448391 ACACTCTCCCTCCCACTTCCTGG + Intronic
931653377 2:64488668-64488690 TCACTCTCCCTCCCACCTGCCGG - Intergenic
932305076 2:70696209-70696231 GCAGTGCCCCACCCAATTCCAGG + Intronic
933707954 2:85305419-85305441 GCACCCTCCCACCTGAATCCAGG - Intronic
934482572 2:94665049-94665071 GCAGAGTCCCACCCCACTCCTGG + Intergenic
938716668 2:134027856-134027878 GCACTTCCCTCCCCAACTCCGGG - Intergenic
942338097 2:174912999-174913021 GCACTCTCCCATTCTACTCATGG - Intronic
945591997 2:211745447-211745469 GCAGCCTCCAACCCCACTCCAGG + Intronic
946236315 2:218326643-218326665 ATACTCTCCCACCCAACTCCAGG - Intronic
946307612 2:218865118-218865140 GACCTCTCCCCACCAACTCCTGG - Intronic
948004074 2:234592795-234592817 GCACTCTCCCACCTGAGTCCTGG - Intergenic
948136377 2:235639334-235639356 GAGCTCACCCACCCACCTCCAGG - Intronic
948572548 2:238926843-238926865 GCACTCTGCCATCCCACTCCTGG - Intergenic
948924858 2:241088827-241088849 GCACTCTCTCAGCCCTCTCCTGG - Exonic
1169032170 20:2417960-2417982 GCCCTCTCCCACAGAACACCTGG - Intronic
1169181408 20:3571491-3571513 GCACTCTCACACACTACTGCTGG - Intronic
1170627916 20:18043528-18043550 GGACTCTCCATCCCAACTCAGGG + Intronic
1171425266 20:25044853-25044875 GCAGTCTGCCACCCGACTCCAGG - Intronic
1172808530 20:37630802-37630824 CCCTTCTCCCTCCCAACTCCTGG - Intergenic
1173642779 20:44615479-44615501 GCATCCACCCACCCAAGTCCTGG + Intronic
1175199547 20:57267847-57267869 CCACTCTCTCACCCAGCCCCAGG - Intergenic
1175343437 20:58250561-58250583 CCACTCTACCACCTCACTCCTGG - Intergenic
1175517495 20:59578346-59578368 GCTCTCCTCCACCCCACTCCGGG - Intronic
1175950647 20:62581456-62581478 GTACTCCCCCACCCCACGCCAGG + Intergenic
1176237280 20:64059467-64059489 TCCCTCTCCCTCCCAACTCTGGG + Intronic
1176513910 21:7769075-7769097 CCAATCTCCCCGCCAACTCCAGG - Intronic
1176863280 21:14026410-14026432 GCTCTCTCCCTACCAACTACTGG - Intergenic
1178648023 21:34399599-34399621 CCAATCTCCCCGCCAACTCCAGG - Intronic
1178927973 21:36791824-36791846 GCAGCCTCCCACCCCACCCCCGG + Intronic
1180153961 21:45968648-45968670 GCCCTGCCCCACCCACCTCCTGG - Intergenic
1180716985 22:17878411-17878433 CCACTCTCCGACCCAGCACCAGG + Intronic
1180918586 22:19506485-19506507 CCACTGCCCCTCCCAACTCCTGG - Intronic
1182419369 22:30241512-30241534 GCACCCTCCACCCCAACCCCAGG + Exonic
1183186913 22:36297141-36297163 AGACACTCGCACCCAACTCCTGG + Intronic
1185277214 22:49954980-49955002 GCTCTCTCCCACCCAGAGCCAGG - Intergenic
950628566 3:14266568-14266590 GGAATCTCCCACCCGCCTCCAGG + Intergenic
950693474 3:14679456-14679478 GCACTCAACCATCCACCTCCAGG - Intronic
951531849 3:23705377-23705399 GCACCCTCCCTGCCCACTCCTGG + Intergenic
951811175 3:26701701-26701723 ACACTCTGCCTCCCAACTCCAGG + Intronic
953540616 3:43814519-43814541 CCAATCTCCCAGCCAACTCCTGG - Intergenic
955071395 3:55575332-55575354 GCACTTTCCCACCCTCTTCCTGG + Intronic
961482550 3:127193367-127193389 GCACTCTCCCACCCAACTCCTGG + Intronic
961661928 3:128473531-128473553 TCTCTATCCCACCCAACTCAGGG - Intergenic
962286213 3:134087438-134087460 GCACTCGCCCACCTCACTCTGGG - Intronic
962866869 3:139454384-139454406 GCCCTGTCCCACCCTCCTCCAGG + Intronic
963630113 3:147721799-147721821 GCTTTCTCCCACCCATCCCCAGG + Intergenic
966327997 3:178778749-178778771 ACACCCTCCAACCCGACTCCTGG + Intronic
966689146 3:182725665-182725687 GTAACCTCCCACCCAACCCCAGG + Intergenic
966930593 3:184673100-184673122 GCATCCTCCCGCCCAACTGCAGG - Intronic
968489907 4:884394-884416 TCCCTCTCCCAGCCCACTCCTGG - Intronic
968551097 4:1223690-1223712 GCACCTTCCCACCCCACACCTGG + Intronic
968968201 4:3780211-3780233 GCACGCCCACACCCACCTCCAGG - Intergenic
969376830 4:6768563-6768585 GCCCTTTCCCACCCAGCTCTGGG - Intergenic
969621204 4:8279811-8279833 GCACTCACCCACCCCACGCCGGG + Intronic
971955780 4:33416543-33416565 GAGCCCACCCACCCAACTCCTGG - Intergenic
973312507 4:48724563-48724585 GCCCCCCCGCACCCAACTCCTGG - Intronic
973803881 4:54505771-54505793 TCAATCTCCTTCCCAACTCCTGG - Intergenic
981527067 4:145717164-145717186 GCCCCCACCCACCCAACTTCAGG - Intronic
982198405 4:152937367-152937389 GCCGTCTCCCACCCAACTTCTGG + Intronic
984580662 4:181506357-181506379 GCACTGTCCTGCCCAAATCCAGG + Intergenic
985748350 5:1660367-1660389 GCACTCTCCTAACCACCTCATGG + Intergenic
988039134 5:25865299-25865321 CCTCTCTCCAACCCAACTCCTGG + Intergenic
988772924 5:34450011-34450033 GCACACTCCTGCCCAACTTCTGG - Intergenic
988984986 5:36609099-36609121 GCACTCTCTCACCCAGCAACTGG + Intronic
992550136 5:77851975-77851997 GCACTCTCGCTCCCGGCTCCCGG + Intronic
997263279 5:132479875-132479897 GCTCTATCCCACACTACTCCAGG + Intergenic
997370008 5:133353492-133353514 ACACTCTCCTGCCAAACTCCAGG - Intronic
997756155 5:136401124-136401146 GCATTCTCCCCTCCAAATCCGGG - Intergenic
998067169 5:139169069-139169091 GCACTATACCATCCAACTCCTGG - Intronic
1000770465 5:165346977-165346999 TCACTCTAGCCCCCAACTCCCGG - Intergenic
1001257255 5:170193388-170193410 GCACCCTGCTACACAACTCCAGG - Intergenic
1002259134 5:177982144-177982166 CCACTCTCCCTCCCACCCCCAGG + Intergenic
1002636463 5:180611290-180611312 GCTTTCTCCCACCCTACTCCTGG + Intronic
1003107591 6:3227870-3227892 GCACGCCCCCACCATACTCCCGG - Intronic
1003507525 6:6751965-6751987 GCACACTCACACCCATGTCCAGG + Intergenic
1004399406 6:15274610-15274632 GAAATCTCCCACTCACCTCCTGG - Intronic
1006393984 6:33775111-33775133 TCAAACTCCCACCCAATTCCTGG - Intronic
1006750468 6:36373578-36373600 CCTCCCTCCCACCCACCTCCAGG - Exonic
1006902285 6:37510980-37511002 TCACTCTCTCACCCTACTCCTGG + Intergenic
1008166101 6:48140344-48140366 CCACTCTTCTACCCAATTCCTGG - Intergenic
1009771641 6:68151281-68151303 ACACAGTCCAACCCAACTCCAGG + Intergenic
1012971076 6:105731818-105731840 GCAGTCTCCCTCCCACCCCCTGG + Intergenic
1013651216 6:112196711-112196733 CCAATCTCCCACCCCATTCCAGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1023864330 7:44231766-44231788 AGACTCTCCCACCCTGCTCCAGG + Intronic
1024064623 7:45722082-45722104 GCAACCCCCCACCCAACTCTGGG + Exonic
1026178280 7:68016660-68016682 CCAATCTCCCACCCAACTTTTGG + Intergenic
1026869547 7:73842113-73842135 GCAGGCTCCCACCCTCCTCCTGG + Exonic
1026877956 7:73890512-73890534 GGACTCCCCCATCCAACTCCAGG - Intergenic
1026895503 7:74007934-74007956 GCCCACTCCCACCTCACTCCAGG + Intergenic
1028121284 7:87059280-87059302 GCCCTCCCCCAGCAAACTCCAGG + Intronic
1032119627 7:129146313-129146335 GCACTCAGCCATCCTACTCCTGG + Intronic
1032320676 7:130883873-130883895 TCTCTCAACCACCCAACTCCCGG - Intergenic
1033669551 7:143478043-143478065 GCACCGTCCCAACCAACTGCAGG - Exonic
1034395898 7:150824817-150824839 GCCCTCCCCCACCCCACTCCCGG + Intronic
1035145321 7:156810287-156810309 GAACTCACTCACCCACCTCCCGG + Intronic
1036378522 8:8220877-8220899 TCACTCCACCACCCACCTCCCGG + Intergenic
1039161734 8:34629091-34629113 GCACTGCCCCACCTAATTCCAGG - Intergenic
1040055790 8:43056199-43056221 GCACACTCCCACCCATACCCCGG + Exonic
1040062371 8:43114809-43114831 GCACTCTCCCAGTCATCTCAAGG + Intronic
1040603785 8:48910137-48910159 GCCTCCTCCCACCCACCTCCTGG + Intergenic
1042237508 8:66627705-66627727 CAACTCTGCCACCTAACTCCAGG + Intergenic
1043958458 8:86389741-86389763 GCGCCCCCCCACCCACCTCCCGG + Intronic
1047220677 8:122916011-122916033 GCCATCTCTCACCCAAGTCCAGG + Intronic
1049298906 8:141859335-141859357 GCATCCTTCCACCCAACTCAAGG - Intergenic
1049663928 8:143834781-143834803 CCTCTCTCCCACTCCACTCCTGG - Exonic
1049949171 9:627707-627729 GCACTCTCCCATCCACCCTCTGG - Intronic
1050975683 9:11935379-11935401 GCACCCTCCCCTCCCACTCCAGG - Intergenic
1053157277 9:35790512-35790534 ATACACTCCCACCCCACTCCAGG + Intergenic
1053925054 9:43046027-43046049 GCAGAGTCCCACCCCACTCCTGG - Intergenic
1054288542 9:63258218-63258240 GCAGAGTCCCACCCCACTCCTGG - Intergenic
1054386369 9:64559755-64559777 GCAGAGTCCCACCCCACTCCTGG - Intergenic
1054509351 9:65956600-65956622 GCAGAGTCCCACCCCACTCCTGG + Intergenic
1054916949 9:70503492-70503514 GTCCTGTCCCCCCCAACTCCCGG + Intergenic
1055455119 9:76465055-76465077 GCACACTGCCATCAAACTCCTGG + Intronic
1056280757 9:85039086-85039108 CCACCCTCCCACCCAACCCTTGG - Intergenic
1057486693 9:95490404-95490426 GCACTGCACCCCCCAACTCCTGG - Intronic
1059336729 9:113573712-113573734 GCACTGCCCCTCCCAACACCAGG + Intronic
1060362219 9:122970282-122970304 ACACTATCACACCCAACTCATGG - Intronic
1061796008 9:133086366-133086388 GCCCTTTGCCACCCCACTCCGGG + Intronic
1062026878 9:134344596-134344618 GCCCTCTCCTCCCCACCTCCCGG + Intronic
1062522320 9:136963447-136963469 GCATCCTCCCAGCCAACTCGGGG - Intergenic
1062665385 9:137668329-137668351 CCACTCACCCACCCACCACCTGG + Intronic
1185579400 X:1198469-1198491 ACACCCTCCCTCCCACCTCCCGG + Intronic
1187521676 X:20019854-20019876 TCACTCTGCTGCCCAACTCCAGG + Intronic
1189259902 X:39670851-39670873 CCTCTCTCCCACCTAACTCCTGG + Intergenic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1192561871 X:72132515-72132537 GGAGTCTCCCACCCAGCTCTCGG - Intergenic
1196683814 X:118494904-118494926 GCCCACCCCCACCCCACTCCTGG + Intergenic
1196683832 X:118494975-118494997 GCCCACCCCCACCCCACTCCTGG + Intergenic
1199629232 X:149764650-149764672 CCCCTCACCCACCCAACCCCTGG + Intergenic
1200850828 Y:7881407-7881429 TCACAGTCCCACACAACTCCTGG + Intergenic
1200863672 Y:8019611-8019633 TGACTCTCCCACCCAAAGCCAGG - Intergenic
1202379822 Y:24266833-24266855 GGGCTCTCCCACCCAACTCGCGG + Intergenic
1202490960 Y:25403288-25403310 GGGCTCTCCCACCCAACTCGCGG - Intergenic