ID: 961484261

View in Genome Browser
Species Human (GRCh38)
Location 3:127206530-127206552
Sequence CCCCTAGGACACCCTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961484250_961484261 23 Left 961484250 3:127206484-127206506 CCACTCACACTCTATCTCTGTGC No data
Right 961484261 3:127206530-127206552 CCCCTAGGACACCCTGAGGATGG No data
961484249_961484261 24 Left 961484249 3:127206483-127206505 CCCACTCACACTCTATCTCTGTG No data
Right 961484261 3:127206530-127206552 CCCCTAGGACACCCTGAGGATGG No data
961484248_961484261 25 Left 961484248 3:127206482-127206504 CCCCACTCACACTCTATCTCTGT No data
Right 961484261 3:127206530-127206552 CCCCTAGGACACCCTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961484261 Original CRISPR CCCCTAGGACACCCTGAGGA TGG Intergenic
No off target data available for this crispr