ID: 961486154

View in Genome Browser
Species Human (GRCh38)
Location 3:127218184-127218206
Sequence AGGGAGATAAGAATGGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961486154_961486159 0 Left 961486154 3:127218184-127218206 CCCTGAGCCATTCTTATCTCCCT No data
Right 961486159 3:127218207-127218229 AAGTAGAGCTCCGTGCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961486154 Original CRISPR AGGGAGATAAGAATGGCTCA GGG (reversed) Intergenic
No off target data available for this crispr