ID: 961488928

View in Genome Browser
Species Human (GRCh38)
Location 3:127237625-127237647
Sequence CGGGCTGTGACCAGTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961488928_961488933 21 Left 961488928 3:127237625-127237647 CCAGCAGAACTGGTCACAGCCCG No data
Right 961488933 3:127237669-127237691 TTTTCCACGTTCTGAAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961488928 Original CRISPR CGGGCTGTGACCAGTTCTGC TGG (reversed) Intergenic
No off target data available for this crispr