ID: 961491195

View in Genome Browser
Species Human (GRCh38)
Location 3:127257816-127257838
Sequence CCTGAGTCTTTGTGGAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961491195_961491204 20 Left 961491195 3:127257816-127257838 CCAGACTTCCACAAAGACTCAGG No data
Right 961491204 3:127257859-127257881 GCCCCCAGCCTCCAGCTGTCAGG No data
961491195_961491211 28 Left 961491195 3:127257816-127257838 CCAGACTTCCACAAAGACTCAGG No data
Right 961491211 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
961491195_961491206 21 Left 961491195 3:127257816-127257838 CCAGACTTCCACAAAGACTCAGG No data
Right 961491206 3:127257860-127257882 CCCCCAGCCTCCAGCTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961491195 Original CRISPR CCTGAGTCTTTGTGGAAGTC TGG (reversed) Intergenic
No off target data available for this crispr