ID: 961491198

View in Genome Browser
Species Human (GRCh38)
Location 3:127257824-127257846
Sequence ACCAGAGGCCTGAGTCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961491198_961491213 30 Left 961491198 3:127257824-127257846 CCACAAAGACTCAGGCCTCTGGT No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491198_961491211 20 Left 961491198 3:127257824-127257846 CCACAAAGACTCAGGCCTCTGGT No data
Right 961491211 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
961491198_961491206 13 Left 961491198 3:127257824-127257846 CCACAAAGACTCAGGCCTCTGGT No data
Right 961491206 3:127257860-127257882 CCCCCAGCCTCCAGCTGTCAGGG No data
961491198_961491204 12 Left 961491198 3:127257824-127257846 CCACAAAGACTCAGGCCTCTGGT No data
Right 961491204 3:127257859-127257881 GCCCCCAGCCTCCAGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961491198 Original CRISPR ACCAGAGGCCTGAGTCTTTG TGG (reversed) Intergenic
No off target data available for this crispr