ID: 961491199

View in Genome Browser
Species Human (GRCh38)
Location 3:127257839-127257861
Sequence GGCTGATGGGGCAGGACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961491199_961491218 24 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491218 3:127257886-127257908 TAGGCTCTGAGCGGGTGGTGGGG No data
961491199_961491206 -2 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491206 3:127257860-127257882 CCCCCAGCCTCCAGCTGTCAGGG No data
961491199_961491204 -3 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491204 3:127257859-127257881 GCCCCCAGCCTCCAGCTGTCAGG No data
961491199_961491219 25 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491219 3:127257887-127257909 AGGCTCTGAGCGGGTGGTGGGGG No data
961491199_961491216 22 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491216 3:127257884-127257906 AGTAGGCTCTGAGCGGGTGGTGG No data
961491199_961491217 23 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491199_961491213 15 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491199_961491211 5 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491211 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
961491199_961491215 19 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data
961491199_961491214 16 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491214 3:127257878-127257900 CAGGGCAGTAGGCTCTGAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961491199 Original CRISPR GGCTGATGGGGCAGGACCAG AGG (reversed) Intergenic
No off target data available for this crispr