ID: 961491203

View in Genome Browser
Species Human (GRCh38)
Location 3:127257853-127257875
Sequence AGCTGGAGGCTGGGGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961491203_961491215 5 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data
961491203_961491220 23 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data
961491203_961491214 2 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491214 3:127257878-127257900 CAGGGCAGTAGGCTCTGAGCGGG No data
961491203_961491221 24 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491221 3:127257900-127257922 GTGGTGGGGGACCAGCTCCAGGG No data
961491203_961491213 1 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491203_961491217 9 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491203_961491219 11 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491219 3:127257887-127257909 AGGCTCTGAGCGGGTGGTGGGGG No data
961491203_961491218 10 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491218 3:127257886-127257908 TAGGCTCTGAGCGGGTGGTGGGG No data
961491203_961491216 8 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491216 3:127257884-127257906 AGTAGGCTCTGAGCGGGTGGTGG No data
961491203_961491211 -9 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491211 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961491203 Original CRISPR AGCTGGAGGCTGGGGGCTGA TGG (reversed) Intergenic
No off target data available for this crispr