ID: 961491211

View in Genome Browser
Species Human (GRCh38)
Location 3:127257867-127257889
Sequence CCTCCAGCTGTCAGGGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961491202_961491211 -8 Left 961491202 3:127257852-127257874 CCCATCAGCCCCCAGCCTCCAGC No data
Right 961491211 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
961491203_961491211 -9 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491211 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
961491201_961491211 -7 Left 961491201 3:127257851-127257873 CCCCATCAGCCCCCAGCCTCCAG No data
Right 961491211 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
961491195_961491211 28 Left 961491195 3:127257816-127257838 CCAGACTTCCACAAAGACTCAGG No data
Right 961491211 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
961491199_961491211 5 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491211 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
961491200_961491211 -3 Left 961491200 3:127257847-127257869 CCTGCCCCATCAGCCCCCAGCCT No data
Right 961491211 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
961491198_961491211 20 Left 961491198 3:127257824-127257846 CCACAAAGACTCAGGCCTCTGGT No data
Right 961491211 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961491211 Original CRISPR CCTCCAGCTGTCAGGGCAGT AGG Intergenic
No off target data available for this crispr