ID: 961491212

View in Genome Browser
Species Human (GRCh38)
Location 3:127257870-127257892
Sequence GAGCCTACTGCCCTGACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961491212_961491224 22 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491224 3:127257915-127257937 CTCCAGGGCCTTCTGTCTTAGGG No data
961491212_961491217 -8 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491212_961491218 -7 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491218 3:127257886-127257908 TAGGCTCTGAGCGGGTGGTGGGG No data
961491212_961491216 -9 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491216 3:127257884-127257906 AGTAGGCTCTGAGCGGGTGGTGG No data
961491212_961491225 23 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491225 3:127257916-127257938 TCCAGGGCCTTCTGTCTTAGGGG No data
961491212_961491220 6 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data
961491212_961491219 -6 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491219 3:127257887-127257909 AGGCTCTGAGCGGGTGGTGGGGG No data
961491212_961491223 21 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491223 3:127257914-127257936 GCTCCAGGGCCTTCTGTCTTAGG No data
961491212_961491221 7 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491221 3:127257900-127257922 GTGGTGGGGGACCAGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961491212 Original CRISPR GAGCCTACTGCCCTGACAGC TGG (reversed) Intergenic
No off target data available for this crispr