ID: 961491213

View in Genome Browser
Species Human (GRCh38)
Location 3:127257877-127257899
Sequence TCAGGGCAGTAGGCTCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961491202_961491213 2 Left 961491202 3:127257852-127257874 CCCATCAGCCCCCAGCCTCCAGC No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491209_961491213 -9 Left 961491209 3:127257863-127257885 CCAGCCTCCAGCTGTCAGGGCAG No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491208_961491213 -8 Left 961491208 3:127257862-127257884 CCCAGCCTCCAGCTGTCAGGGCA No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491205_961491213 -6 Left 961491205 3:127257860-127257882 CCCCCAGCCTCCAGCTGTCAGGG No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491200_961491213 7 Left 961491200 3:127257847-127257869 CCTGCCCCATCAGCCCCCAGCCT No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491201_961491213 3 Left 961491201 3:127257851-127257873 CCCCATCAGCCCCCAGCCTCCAG No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491203_961491213 1 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491198_961491213 30 Left 961491198 3:127257824-127257846 CCACAAAGACTCAGGCCTCTGGT No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491199_961491213 15 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data
961491207_961491213 -7 Left 961491207 3:127257861-127257883 CCCCAGCCTCCAGCTGTCAGGGC No data
Right 961491213 3:127257877-127257899 TCAGGGCAGTAGGCTCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961491213 Original CRISPR TCAGGGCAGTAGGCTCTGAG CGG Intergenic
No off target data available for this crispr