ID: 961491215

View in Genome Browser
Species Human (GRCh38)
Location 3:127257881-127257903
Sequence GGCAGTAGGCTCTGAGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961491202_961491215 6 Left 961491202 3:127257852-127257874 CCCATCAGCCCCCAGCCTCCAGC No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data
961491208_961491215 -4 Left 961491208 3:127257862-127257884 CCCAGCCTCCAGCTGTCAGGGCA No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data
961491199_961491215 19 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data
961491203_961491215 5 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data
961491210_961491215 -9 Left 961491210 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data
961491201_961491215 7 Left 961491201 3:127257851-127257873 CCCCATCAGCCCCCAGCCTCCAG No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data
961491200_961491215 11 Left 961491200 3:127257847-127257869 CCTGCCCCATCAGCCCCCAGCCT No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data
961491205_961491215 -2 Left 961491205 3:127257860-127257882 CCCCCAGCCTCCAGCTGTCAGGG No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data
961491209_961491215 -5 Left 961491209 3:127257863-127257885 CCAGCCTCCAGCTGTCAGGGCAG No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data
961491207_961491215 -3 Left 961491207 3:127257861-127257883 CCCCAGCCTCCAGCTGTCAGGGC No data
Right 961491215 3:127257881-127257903 GGCAGTAGGCTCTGAGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961491215 Original CRISPR GGCAGTAGGCTCTGAGCGGG TGG Intergenic
No off target data available for this crispr