ID: 961491217

View in Genome Browser
Species Human (GRCh38)
Location 3:127257885-127257907
Sequence GTAGGCTCTGAGCGGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961491205_961491217 2 Left 961491205 3:127257860-127257882 CCCCCAGCCTCCAGCTGTCAGGG No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491202_961491217 10 Left 961491202 3:127257852-127257874 CCCATCAGCCCCCAGCCTCCAGC No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491210_961491217 -5 Left 961491210 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491200_961491217 15 Left 961491200 3:127257847-127257869 CCTGCCCCATCAGCCCCCAGCCT No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491209_961491217 -1 Left 961491209 3:127257863-127257885 CCAGCCTCCAGCTGTCAGGGCAG No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491207_961491217 1 Left 961491207 3:127257861-127257883 CCCCAGCCTCCAGCTGTCAGGGC No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491201_961491217 11 Left 961491201 3:127257851-127257873 CCCCATCAGCCCCCAGCCTCCAG No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491199_961491217 23 Left 961491199 3:127257839-127257861 CCTCTGGTCCTGCCCCATCAGCC No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491208_961491217 0 Left 961491208 3:127257862-127257884 CCCAGCCTCCAGCTGTCAGGGCA No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491203_961491217 9 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data
961491212_961491217 -8 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491217 3:127257885-127257907 GTAGGCTCTGAGCGGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961491217 Original CRISPR GTAGGCTCTGAGCGGGTGGT GGG Intergenic
No off target data available for this crispr