ID: 961491220

View in Genome Browser
Species Human (GRCh38)
Location 3:127257899-127257921
Sequence GGTGGTGGGGGACCAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961491203_961491220 23 Left 961491203 3:127257853-127257875 CCATCAGCCCCCAGCCTCCAGCT No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data
961491200_961491220 29 Left 961491200 3:127257847-127257869 CCTGCCCCATCAGCCCCCAGCCT No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data
961491205_961491220 16 Left 961491205 3:127257860-127257882 CCCCCAGCCTCCAGCTGTCAGGG No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data
961491212_961491220 6 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data
961491207_961491220 15 Left 961491207 3:127257861-127257883 CCCCAGCCTCCAGCTGTCAGGGC No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data
961491202_961491220 24 Left 961491202 3:127257852-127257874 CCCATCAGCCCCCAGCCTCCAGC No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data
961491210_961491220 9 Left 961491210 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data
961491201_961491220 25 Left 961491201 3:127257851-127257873 CCCCATCAGCCCCCAGCCTCCAG No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data
961491209_961491220 13 Left 961491209 3:127257863-127257885 CCAGCCTCCAGCTGTCAGGGCAG No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data
961491208_961491220 14 Left 961491208 3:127257862-127257884 CCCAGCCTCCAGCTGTCAGGGCA No data
Right 961491220 3:127257899-127257921 GGTGGTGGGGGACCAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961491220 Original CRISPR GGTGGTGGGGGACCAGCTCC AGG Intergenic
No off target data available for this crispr