ID: 961491223

View in Genome Browser
Species Human (GRCh38)
Location 3:127257914-127257936
Sequence GCTCCAGGGCCTTCTGTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961491210_961491223 24 Left 961491210 3:127257867-127257889 CCTCCAGCTGTCAGGGCAGTAGG No data
Right 961491223 3:127257914-127257936 GCTCCAGGGCCTTCTGTCTTAGG No data
961491207_961491223 30 Left 961491207 3:127257861-127257883 CCCCAGCCTCCAGCTGTCAGGGC No data
Right 961491223 3:127257914-127257936 GCTCCAGGGCCTTCTGTCTTAGG No data
961491212_961491223 21 Left 961491212 3:127257870-127257892 CCAGCTGTCAGGGCAGTAGGCTC No data
Right 961491223 3:127257914-127257936 GCTCCAGGGCCTTCTGTCTTAGG No data
961491209_961491223 28 Left 961491209 3:127257863-127257885 CCAGCCTCCAGCTGTCAGGGCAG No data
Right 961491223 3:127257914-127257936 GCTCCAGGGCCTTCTGTCTTAGG No data
961491208_961491223 29 Left 961491208 3:127257862-127257884 CCCAGCCTCCAGCTGTCAGGGCA No data
Right 961491223 3:127257914-127257936 GCTCCAGGGCCTTCTGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961491223 Original CRISPR GCTCCAGGGCCTTCTGTCTT AGG Intergenic
No off target data available for this crispr