ID: 961495302

View in Genome Browser
Species Human (GRCh38)
Location 3:127287302-127287324
Sequence GTTTGATGGTACCTTGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961495296_961495302 24 Left 961495296 3:127287255-127287277 CCAAAGGTAAAGTAAAAATCTGG No data
Right 961495302 3:127287302-127287324 GTTTGATGGTACCTTGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961495302 Original CRISPR GTTTGATGGTACCTTGATTT GGG Intergenic
No off target data available for this crispr