ID: 961495384

View in Genome Browser
Species Human (GRCh38)
Location 3:127287680-127287702
Sequence CCAGGAGGCCTAAGTCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961495384_961495394 20 Left 961495384 3:127287680-127287702 CCGGGGAGACTTAGGCCTCCTGG No data
Right 961495394 3:127287723-127287745 GGAAGAGAGAAAAAAGATGGAGG No data
961495384_961495389 -1 Left 961495384 3:127287680-127287702 CCGGGGAGACTTAGGCCTCCTGG No data
Right 961495389 3:127287702-127287724 GAGGAATGATCCCTCCTTAGCGG No data
961495384_961495397 26 Left 961495384 3:127287680-127287702 CCGGGGAGACTTAGGCCTCCTGG No data
Right 961495397 3:127287729-127287751 GAGAAAAAAGATGGAGGATGGGG No data
961495384_961495396 25 Left 961495384 3:127287680-127287702 CCGGGGAGACTTAGGCCTCCTGG No data
Right 961495396 3:127287728-127287750 AGAGAAAAAAGATGGAGGATGGG No data
961495384_961495395 24 Left 961495384 3:127287680-127287702 CCGGGGAGACTTAGGCCTCCTGG No data
Right 961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG No data
961495384_961495393 17 Left 961495384 3:127287680-127287702 CCGGGGAGACTTAGGCCTCCTGG No data
Right 961495393 3:127287720-127287742 AGCGGAAGAGAGAAAAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961495384 Original CRISPR CCAGGAGGCCTAAGTCTCCC CGG (reversed) Intergenic
No off target data available for this crispr