ID: 961495387

View in Genome Browser
Species Human (GRCh38)
Location 3:127287695-127287717
Sequence GGAGGGATCATTCCTCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961495387_961495396 10 Left 961495387 3:127287695-127287717 CCTCCTGGAGGAATGATCCCTCC No data
Right 961495396 3:127287728-127287750 AGAGAAAAAAGATGGAGGATGGG No data
961495387_961495395 9 Left 961495387 3:127287695-127287717 CCTCCTGGAGGAATGATCCCTCC No data
Right 961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG No data
961495387_961495393 2 Left 961495387 3:127287695-127287717 CCTCCTGGAGGAATGATCCCTCC No data
Right 961495393 3:127287720-127287742 AGCGGAAGAGAGAAAAAAGATGG No data
961495387_961495397 11 Left 961495387 3:127287695-127287717 CCTCCTGGAGGAATGATCCCTCC No data
Right 961495397 3:127287729-127287751 GAGAAAAAAGATGGAGGATGGGG No data
961495387_961495394 5 Left 961495387 3:127287695-127287717 CCTCCTGGAGGAATGATCCCTCC No data
Right 961495394 3:127287723-127287745 GGAAGAGAGAAAAAAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961495387 Original CRISPR GGAGGGATCATTCCTCCAGG AGG (reversed) Intergenic
No off target data available for this crispr