ID: 961495389

View in Genome Browser
Species Human (GRCh38)
Location 3:127287702-127287724
Sequence GAGGAATGATCCCTCCTTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961495377_961495389 25 Left 961495377 3:127287654-127287676 CCCAGTTTCTTCAGGCAAAGCTG No data
Right 961495389 3:127287702-127287724 GAGGAATGATCCCTCCTTAGCGG No data
961495378_961495389 24 Left 961495378 3:127287655-127287677 CCAGTTTCTTCAGGCAAAGCTGG No data
Right 961495389 3:127287702-127287724 GAGGAATGATCCCTCCTTAGCGG No data
961495384_961495389 -1 Left 961495384 3:127287680-127287702 CCGGGGAGACTTAGGCCTCCTGG No data
Right 961495389 3:127287702-127287724 GAGGAATGATCCCTCCTTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961495389 Original CRISPR GAGGAATGATCCCTCCTTAG CGG Intergenic
No off target data available for this crispr