ID: 961495391

View in Genome Browser
Species Human (GRCh38)
Location 3:127287713-127287735
Sequence TTTTCTCTCTTCCGCTAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961495391_961495396 -8 Left 961495391 3:127287713-127287735 CCTCCTTAGCGGAAGAGAGAAAA No data
Right 961495396 3:127287728-127287750 AGAGAAAAAAGATGGAGGATGGG No data
961495391_961495395 -9 Left 961495391 3:127287713-127287735 CCTCCTTAGCGGAAGAGAGAAAA No data
Right 961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG No data
961495391_961495399 26 Left 961495391 3:127287713-127287735 CCTCCTTAGCGGAAGAGAGAAAA No data
Right 961495399 3:127287762-127287784 CGAAGAAGACAGCGGTGACAAGG No data
961495391_961495397 -7 Left 961495391 3:127287713-127287735 CCTCCTTAGCGGAAGAGAGAAAA No data
Right 961495397 3:127287729-127287751 GAGAAAAAAGATGGAGGATGGGG No data
961495391_961495398 18 Left 961495391 3:127287713-127287735 CCTCCTTAGCGGAAGAGAGAAAA No data
Right 961495398 3:127287754-127287776 CAGAGTTGCGAAGAAGACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961495391 Original CRISPR TTTTCTCTCTTCCGCTAAGG AGG (reversed) Intergenic
No off target data available for this crispr