ID: 961495394

View in Genome Browser
Species Human (GRCh38)
Location 3:127287723-127287745
Sequence GGAAGAGAGAAAAAAGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961495384_961495394 20 Left 961495384 3:127287680-127287702 CCGGGGAGACTTAGGCCTCCTGG No data
Right 961495394 3:127287723-127287745 GGAAGAGAGAAAAAAGATGGAGG No data
961495388_961495394 2 Left 961495388 3:127287698-127287720 CCTGGAGGAATGATCCCTCCTTA No data
Right 961495394 3:127287723-127287745 GGAAGAGAGAAAAAAGATGGAGG No data
961495387_961495394 5 Left 961495387 3:127287695-127287717 CCTCCTGGAGGAATGATCCCTCC No data
Right 961495394 3:127287723-127287745 GGAAGAGAGAAAAAAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961495394 Original CRISPR GGAAGAGAGAAAAAAGATGG AGG Intergenic
No off target data available for this crispr