ID: 961495395

View in Genome Browser
Species Human (GRCh38)
Location 3:127287727-127287749
Sequence GAGAGAAAAAAGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961495390_961495395 -8 Left 961495390 3:127287712-127287734 CCCTCCTTAGCGGAAGAGAGAAA No data
Right 961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG No data
961495384_961495395 24 Left 961495384 3:127287680-127287702 CCGGGGAGACTTAGGCCTCCTGG No data
Right 961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG No data
961495388_961495395 6 Left 961495388 3:127287698-127287720 CCTGGAGGAATGATCCCTCCTTA No data
Right 961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG No data
961495391_961495395 -9 Left 961495391 3:127287713-127287735 CCTCCTTAGCGGAAGAGAGAAAA No data
Right 961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG No data
961495387_961495395 9 Left 961495387 3:127287695-127287717 CCTCCTGGAGGAATGATCCCTCC No data
Right 961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961495395 Original CRISPR GAGAGAAAAAAGATGGAGGA TGG Intergenic
No off target data available for this crispr